ID: 1082807158

View in Genome Browser
Species Human (GRCh38)
Location 11:57458636-57458658
Sequence CCCCAGGCGCAGGCCCTAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082807134_1082807158 28 Left 1082807134 11:57458585-57458607 CCACCCTGCTACCCCCAACACTC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807144_1082807158 2 Left 1082807144 11:57458611-57458633 CCCCGCCGCCGCCTCCAGGCCCT No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807141_1082807158 6 Left 1082807141 11:57458607-57458629 CCCTCCCCGCCGCCGCCTCCAGG No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807148_1082807158 -6 Left 1082807148 11:57458619-57458641 CCGCCTCCAGGCCCTCCCCCCAG No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807138_1082807158 16 Left 1082807138 11:57458597-57458619 CCCCAACACTCCCTCCCCGCCGC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807147_1082807158 -3 Left 1082807147 11:57458616-57458638 CCGCCGCCTCCAGGCCCTCCCCC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807146_1082807158 0 Left 1082807146 11:57458613-57458635 CCGCCGCCGCCTCCAGGCCCTCC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807135_1082807158 25 Left 1082807135 11:57458588-57458610 CCCTGCTACCCCCAACACTCCCT No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807143_1082807158 5 Left 1082807143 11:57458608-57458630 CCTCCCCGCCGCCGCCTCCAGGC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807145_1082807158 1 Left 1082807145 11:57458612-57458634 CCCGCCGCCGCCTCCAGGCCCTC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807140_1082807158 14 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807137_1082807158 17 Left 1082807137 11:57458596-57458618 CCCCCAACACTCCCTCCCCGCCG No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807132_1082807158 30 Left 1082807132 11:57458583-57458605 CCCCACCCTGCTACCCCCAACAC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807136_1082807158 24 Left 1082807136 11:57458589-57458611 CCTGCTACCCCCAACACTCCCTC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807139_1082807158 15 Left 1082807139 11:57458598-57458620 CCCAACACTCCCTCCCCGCCGCC No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807133_1082807158 29 Left 1082807133 11:57458584-57458606 CCCACCCTGCTACCCCCAACACT No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807150_1082807158 -9 Left 1082807150 11:57458622-57458644 CCTCCAGGCCCTCCCCCCAGGCG No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082807158 Original CRISPR CCCCAGGCGCAGGCCCTAGT CGG Intergenic
No off target data available for this crispr