ID: 1082807165

View in Genome Browser
Species Human (GRCh38)
Location 11:57458648-57458670
Sequence GCCCTAGTCGGGGTGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082807144_1082807165 14 Left 1082807144 11:57458611-57458633 CCCCGCCGCCGCCTCCAGGCCCT No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807141_1082807165 18 Left 1082807141 11:57458607-57458629 CCCTCCCCGCCGCCGCCTCCAGG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807147_1082807165 9 Left 1082807147 11:57458616-57458638 CCGCCGCCTCCAGGCCCTCCCCC No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807146_1082807165 12 Left 1082807146 11:57458613-57458635 CCGCCGCCGCCTCCAGGCCCTCC No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807143_1082807165 17 Left 1082807143 11:57458608-57458630 CCTCCCCGCCGCCGCCTCCAGGC No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807138_1082807165 28 Left 1082807138 11:57458597-57458619 CCCCAACACTCCCTCCCCGCCGC No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807156_1082807165 -10 Left 1082807156 11:57458635-57458657 CCCCCAGGCGCAGGCCCTAGTCG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807151_1082807165 0 Left 1082807151 11:57458625-57458647 CCAGGCCCTCCCCCCAGGCGCAG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807137_1082807165 29 Left 1082807137 11:57458596-57458618 CCCCCAACACTCCCTCCCCGCCG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807139_1082807165 27 Left 1082807139 11:57458598-57458620 CCCAACACTCCCTCCCCGCCGCC No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807148_1082807165 6 Left 1082807148 11:57458619-57458641 CCGCCTCCAGGCCCTCCCCCCAG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807150_1082807165 3 Left 1082807150 11:57458622-57458644 CCTCCAGGCCCTCCCCCCAGGCG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807153_1082807165 -5 Left 1082807153 11:57458630-57458652 CCCTCCCCCCAGGCGCAGGCCCT No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807155_1082807165 -9 Left 1082807155 11:57458634-57458656 CCCCCCAGGCGCAGGCCCTAGTC No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807140_1082807165 26 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807154_1082807165 -6 Left 1082807154 11:57458631-57458653 CCTCCCCCCAGGCGCAGGCCCTA No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807145_1082807165 13 Left 1082807145 11:57458612-57458634 CCCGCCGCCGCCTCCAGGCCCTC No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082807165 Original CRISPR GCCCTAGTCGGGGTGGGTCC TGG Intergenic
No off target data available for this crispr