ID: 1082807169

View in Genome Browser
Species Human (GRCh38)
Location 11:57458650-57458672
Sequence CCTAGTCGGGGTGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082807156_1082807169 -8 Left 1082807156 11:57458635-57458657 CCCCCAGGCGCAGGCCCTAGTCG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807150_1082807169 5 Left 1082807150 11:57458622-57458644 CCTCCAGGCCCTCCCCCCAGGCG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807143_1082807169 19 Left 1082807143 11:57458608-57458630 CCTCCCCGCCGCCGCCTCCAGGC No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807138_1082807169 30 Left 1082807138 11:57458597-57458619 CCCCAACACTCCCTCCCCGCCGC No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807153_1082807169 -3 Left 1082807153 11:57458630-57458652 CCCTCCCCCCAGGCGCAGGCCCT No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807157_1082807169 -9 Left 1082807157 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807147_1082807169 11 Left 1082807147 11:57458616-57458638 CCGCCGCCTCCAGGCCCTCCCCC No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807155_1082807169 -7 Left 1082807155 11:57458634-57458656 CCCCCCAGGCGCAGGCCCTAGTC No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807154_1082807169 -4 Left 1082807154 11:57458631-57458653 CCTCCCCCCAGGCGCAGGCCCTA No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807141_1082807169 20 Left 1082807141 11:57458607-57458629 CCCTCCCCGCCGCCGCCTCCAGG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807140_1082807169 28 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807159_1082807169 -10 Left 1082807159 11:57458637-57458659 CCCAGGCGCAGGCCCTAGTCGGG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807151_1082807169 2 Left 1082807151 11:57458625-57458647 CCAGGCCCTCCCCCCAGGCGCAG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807145_1082807169 15 Left 1082807145 11:57458612-57458634 CCCGCCGCCGCCTCCAGGCCCTC No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807148_1082807169 8 Left 1082807148 11:57458619-57458641 CCGCCTCCAGGCCCTCCCCCCAG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807144_1082807169 16 Left 1082807144 11:57458611-57458633 CCCCGCCGCCGCCTCCAGGCCCT No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807146_1082807169 14 Left 1082807146 11:57458613-57458635 CCGCCGCCGCCTCCAGGCCCTCC No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807139_1082807169 29 Left 1082807139 11:57458598-57458620 CCCAACACTCCCTCCCCGCCGCC No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082807169 Original CRISPR CCTAGTCGGGGTGGGTCCTG GGG Intergenic
No off target data available for this crispr