ID: 1082807645

View in Genome Browser
Species Human (GRCh38)
Location 11:57460766-57460788
Sequence CGGGGACCCCGCGGGGCTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 3, 3: 42, 4: 303}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082807645_1082807661 10 Left 1082807645 11:57460766-57460788 CCCGGAGCCCCGCGGGGTCCCCG 0: 1
1: 1
2: 3
3: 42
4: 303
Right 1082807661 11:57460799-57460821 GGCGGGCTCAGGGAGCGAGTGGG 0: 1
1: 0
2: 3
3: 5
4: 203
1082807645_1082807651 -8 Left 1082807645 11:57460766-57460788 CCCGGAGCCCCGCGGGGTCCCCG 0: 1
1: 1
2: 3
3: 42
4: 303
Right 1082807651 11:57460781-57460803 GGTCCCCGCCGTGCATCCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 56
1082807645_1082807658 0 Left 1082807645 11:57460766-57460788 CCCGGAGCCCCGCGGGGTCCCCG 0: 1
1: 1
2: 3
3: 42
4: 303
Right 1082807658 11:57460789-57460811 CCGTGCATCCGGCGGGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1082807645_1082807656 -1 Left 1082807645 11:57460766-57460788 CCCGGAGCCCCGCGGGGTCCCCG 0: 1
1: 1
2: 3
3: 42
4: 303
Right 1082807656 11:57460788-57460810 GCCGTGCATCCGGCGGGCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1082807645_1082807660 9 Left 1082807645 11:57460766-57460788 CCCGGAGCCCCGCGGGGTCCCCG 0: 1
1: 1
2: 3
3: 42
4: 303
Right 1082807660 11:57460798-57460820 CGGCGGGCTCAGGGAGCGAGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
1082807645_1082807652 -7 Left 1082807645 11:57460766-57460788 CCCGGAGCCCCGCGGGGTCCCCG 0: 1
1: 1
2: 3
3: 42
4: 303
Right 1082807652 11:57460782-57460804 GTCCCCGCCGTGCATCCGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082807645 Original CRISPR CGGGGACCCCGCGGGGCTCC GGG (reversed) Exonic
900117491 1:1034780-1034802 CGGCGGGTCCGCGGGGCTCCCGG + Intronic
900338070 1:2174583-2174605 GGAGGACCCGGCGGGACTCCGGG + Intronic
900783623 1:4633842-4633864 CGTGGACCCCGCCCTGCTCCTGG - Intergenic
901063784 1:6485540-6485562 CGGGGACCCCGGGGAGGGCCGGG + Intronic
901066935 1:6498658-6498680 CAGGCACCCCGGGGGCCTCCAGG + Intronic
901242658 1:7704302-7704324 GGAGGCCCGCGCGGGGCTCCGGG + Intronic
902520237 1:17011684-17011706 CGGGGACCGCGCCGGGCTCGGGG + Intronic
902585844 1:17438325-17438347 CGGGGGCCCCGTCGAGCTCCAGG + Exonic
902703836 1:18191051-18191073 GGGGGACCCTGCGAGGCTCCAGG + Intronic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
905067024 1:35192612-35192634 CGGGGGCCCCGCCAGGGTCCGGG - Exonic
905239432 1:36572273-36572295 TGGGGAAGCCGCCGGGCTCCAGG - Intergenic
905886915 1:41496559-41496581 CAGGGCCCCCGCAGGGGTCCGGG - Intergenic
905909059 1:41641381-41641403 CGGGGACCCAGCCAGGCTTCTGG + Intronic
905995991 1:42380884-42380906 CGCGGACCCCTCGGCGCCCCGGG - Exonic
906525412 1:46490585-46490607 CGCGAACCCCGCAGTGCTCCGGG + Intergenic
908401322 1:63774700-63774722 CCGGCCCGCCGCGGGGCTCCGGG - Intronic
909548035 1:76868673-76868695 CGGGGACCCCGGGGCGCTGCTGG - Exonic
909958241 1:81802981-81803003 CGGGGACCCGGCGGGCCACGGGG + Intronic
912381365 1:109249769-109249791 CGGGGGCCCCGCGGCGCCCCTGG - Intergenic
912381366 1:109249770-109249792 CAGGGGCGCCGCGGGGCCCCCGG + Intergenic
915549962 1:156625996-156626018 CGGCGCCCCCGCGTGGCGCCTGG - Intergenic
915559301 1:156677132-156677154 CGCGGAGCTCGGGGGGCTCCGGG - Exonic
918040753 1:180912768-180912790 AGGCGGCCCCGCGGGGCTCCGGG + Intergenic
918065905 1:181101662-181101684 CGGGAACCCAGCTGGGCTGCAGG - Intergenic
923452589 1:234133449-234133471 TGGGGACCCTGCAGGCCTCCTGG - Intronic
923744412 1:236686838-236686860 CGGGAGCCCCGCGGGGGACCCGG - Intronic
1062982416 10:1736760-1736782 CGGGGACCCCGCGCGTCTCCGGG - Intronic
1063664862 10:8055142-8055164 CGCGGAGCCCGCAGGGCTCTCGG - Intronic
1063822478 10:9853801-9853823 CGGGGACCCAGCTGGACTCCGGG - Intergenic
1064982111 10:21174659-21174681 CGGGTTCCCCGCGGATCTCCCGG - Intergenic
1065099851 10:22321741-22321763 CGGGGGCCGCGCGGGGCTCGGGG + Intronic
1067003388 10:42638420-42638442 AGGGGGCCCCGCGCGACTCCAGG - Intronic
1068080670 10:52314312-52314334 CTGGGACCGCAGGGGGCTCCCGG + Exonic
1069501466 10:68956606-68956628 CGGGGACCACGTGGGACACCCGG - Intronic
1070507367 10:77125898-77125920 AGGGGACCCCGCAGGGCTTCTGG - Intronic
1071521881 10:86336598-86336620 TGGGGACACCACGGGGTTCCAGG - Intronic
1071573759 10:86711610-86711632 CGGGGAGCCCGCGCGGGACCCGG + Intronic
1076722139 10:132397369-132397391 TGGGGACCCCGGGGGTGTCCCGG - Intronic
1076929438 10:133520330-133520352 CGGGGTCCCCTCGGGGCCTCAGG + Intergenic
1076994167 11:290201-290223 GGGGGACCCTGCGGGCCTCTGGG - Intronic
1076999537 11:315783-315805 CCGAGCTCCCGCGGGGCTCCCGG - Intergenic
1077064954 11:637019-637041 CGCGGACCCCGCGCGGCGCCGGG + Intergenic
1077162891 11:1121677-1121699 CCGGGACCCCGGGGTGCACCAGG - Intergenic
1077204784 11:1337000-1337022 CGGGGACCCTGCAGGGCTGTGGG + Intergenic
1077325951 11:1964204-1964226 CGAGGACACCGCCGTGCTCCCGG + Intronic
1077429871 11:2511103-2511125 CTGGCACCACGCTGGGCTCCAGG - Intronic
1077514456 11:2992985-2993007 CTGGGACACTGCGGGGCTCAGGG - Intergenic
1077610898 11:3642519-3642541 CGGGACCCCCGCGGGGCCCCTGG - Intergenic
1078631925 11:13010692-13010714 CGGGGCCACCGTCGGGCTCCAGG - Intergenic
1079284656 11:19117547-19117569 AGAGGTCCCCGCCGGGCTCCGGG - Intronic
1080601851 11:33828924-33828946 CGGGGACCTCGCGGGATCCCAGG - Intergenic
1081845524 11:46238107-46238129 CGGCCTCCCCGCGGGGCTGCAGG + Intergenic
1082807645 11:57460766-57460788 CGGGGACCCCGCGGGGCTCCGGG - Exonic
1083272803 11:61580667-61580689 GGGGGAGCCCGTGCGGCTCCGGG + Intronic
1083393290 11:62371304-62371326 CGGGGGCCCCGTCGAGCTCCAGG - Intronic
1083842839 11:65314739-65314761 CGGGCACCGCCCGGGGCTCCCGG - Intergenic
1084040456 11:66539618-66539640 CGAGGGCCCAGCGGGGCCCCAGG + Exonic
1084070167 11:66728466-66728488 CGGCGGCCCCGCGGGGCTCTGGG + Intronic
1084546936 11:69819289-69819311 GGGGAGCCCCGCGGGGCTCGGGG + Intergenic
1084779207 11:71397559-71397581 GGGAGACACCGCTGGGCTCCAGG + Intergenic
1084791287 11:71476791-71476813 CCGGGAACCTGCGGGGGTCCTGG - Intronic
1089208860 11:116787709-116787731 CGGGGACCCCGAGGAGCGCCCGG - Intronic
1089346970 11:117796944-117796966 CGGGGTGCCCGGCGGGCTCCAGG - Intronic
1089453130 11:118610534-118610556 CGGGCGACCCGCGGGGCTCCGGG + Intronic
1089500515 11:118929095-118929117 CGGGTGCCCCGCGGGTCTCAGGG + Intronic
1202808931 11_KI270721v1_random:19383-19405 CGAGGACACCGCCGTGCTCCCGG + Intergenic
1092270308 12:7018432-7018454 GGGGGTCCCTGTGGGGCTCCCGG - Exonic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096650377 12:53059435-53059457 TGGGAACCCCGCAGGGCTCCCGG - Exonic
1097165936 12:57087025-57087047 AGGGGAGCCAGCGGGGGTCCGGG - Intronic
1097787789 12:63780070-63780092 CCGGGTCCCCGCGGGGCCTCAGG + Exonic
1097872143 12:64610543-64610565 CGGGAACCTCGCGGGGCTGGCGG + Exonic
1098819058 12:75207386-75207408 CGAGGACGCGGCGGGGCTCGGGG - Exonic
1100469046 12:94873809-94873831 CGGGGTCCCCGGGGCTCTCCCGG + Intergenic
1102068608 12:109999460-109999482 CGGGAACGCCGCGGGGCGCGGGG + Intronic
1102219581 12:111185642-111185664 CGGGGTCCCCTCGGGGCTCAGGG - Intronic
1103907669 12:124335714-124335736 CTGGGACCCCGGGGGGGTCAAGG + Intronic
1104042579 12:125140065-125140087 TGGGGACCCCGCGAGGGTCATGG + Intronic
1104889387 12:132132966-132132988 CGTGGGCCCCGCTGCGCTCCTGG - Intergenic
1104983226 12:132583079-132583101 CGGGGCCCCCGCGGAGCGCGAGG + Exonic
1107774407 13:43822903-43822925 CGGGGACCCCAAGGGTCTGCTGG + Intergenic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1117353497 14:54902613-54902635 CGGAGAAGCCGCGGGGCGCCAGG - Exonic
1117699141 14:58396047-58396069 CGGGGTCCCCGCGCCGCTTCCGG - Exonic
1118292972 14:64542253-64542275 GGGGGACCCCGCGAGGCGCAGGG - Exonic
1119385893 14:74258035-74258057 CGGGGGCCGCGAGGGGCTGCCGG + Intronic
1120905705 14:89619214-89619236 CTAGGACCCAGCAGGGCTCCAGG - Intergenic
1121127474 14:91417524-91417546 CCGGGGCCCCGGGTGGCTCCGGG - Intronic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1122470923 14:101965188-101965210 CGGGGCGCCCTGGGGGCTCCGGG - Intronic
1122582287 14:102778024-102778046 CCGGCACCCCGCGGGGCCGCGGG + Intronic
1122649968 14:103220798-103220820 CGGCGACTCCTCGGGGCACCAGG + Intergenic
1122880866 14:104689897-104689919 CGGGGACCCCAGGGCGCCCCTGG + Intronic
1122977932 14:105178595-105178617 ATGGGACCCCGCGGGACCCCAGG - Intronic
1123115119 14:105891054-105891076 CGGGGACACCGTGGGGCTCTGGG + Intergenic
1123119393 14:105909770-105909792 TGGGGACACTGTGGGGCTCCAGG + Intergenic
1123739758 15:23225743-23225765 GGGGGACCCCGCCCGGATCCAGG - Intergenic
1124290983 15:28454716-28454738 GGGGGACCCCGCCCGGATCCAGG - Intergenic
1124789881 15:32717834-32717856 AGGGGACCCCGCGGGGAAGCAGG + Intergenic
1124983315 15:34583439-34583461 CGGGGTCCCCGCGGCGCCGCGGG + Intronic
1125386965 15:39147973-39147995 CAGGGACCTCGCTGGGCCCCTGG + Intergenic
1125685038 15:41559055-41559077 CGGGGACCCCGCGCTGCTGACGG + Exonic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1130261205 15:82355494-82355516 CGGGGGCTGCGCGGGGCTTCAGG + Intergenic
1130280030 15:82513524-82513546 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130471405 15:84229710-84229732 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130478899 15:84344281-84344303 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130492871 15:84443850-84443872 CGGGGGCTGCGCGGGGCTTCAGG + Intergenic
1130593699 15:85234337-85234359 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130613500 15:85381399-85381421 TGGGGACCGCACGGGTCTCCTGG - Intronic
1132105486 15:99059529-99059551 CGGGGACCCCGGCGGGGGCCAGG + Intergenic
1132552444 16:559164-559186 GGAGGACCCCACGGGGCTTCTGG - Intergenic
1132553802 16:564163-564185 CGGAGTCCCAGAGGGGCTCCTGG - Exonic
1132570372 16:641621-641643 CGCTGACCCCGCAGGGCCCCTGG + Intronic
1132625642 16:890271-890293 CGGGGGCCCCTTGGGGCTCCAGG - Intronic
1132683601 16:1153393-1153415 CGCGGACCCCGCTCGGCGCCCGG - Exonic
1132942328 16:2514347-2514369 CGGGGAGCCGCCGGGGGTCCGGG + Intronic
1134849847 16:17470825-17470847 CGGGGACCCCGGCACGCTCCGGG + Exonic
1136412746 16:30086478-30086500 AGGGGACCAGGCGGGGCTGCGGG - Intronic
1136478448 16:30526952-30526974 CCCGGAGCCCGCGGGGCTACCGG + Intronic
1136923439 16:34350500-34350522 CGGGGGAGTCGCGGGGCTCCTGG - Intergenic
1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG + Intergenic
1137261137 16:46830999-46831021 GGGGGGCCTCGCCGGGCTCCCGG - Intronic
1138651465 16:58463694-58463716 CGGGCACGCGGAGGGGCTCCTGG + Intronic
1141054774 16:80804616-80804638 CGGGGGCCGGGCCGGGCTCCCGG - Intergenic
1141054837 16:80804749-80804771 CGGGGCCCCCGGGGGGCGGCGGG + Intergenic
1141837968 16:86555144-86555166 GGGGGGCCTGGCGGGGCTCCGGG - Intronic
1142596276 17:1031537-1031559 CGGGGGCGCTGCGGGGCTCGGGG - Intronic
1143017282 17:3897747-3897769 CTGGGACCCACCAGGGCTCCAGG + Exonic
1143303341 17:5927355-5927377 GAGGGACCCAGCGGGGCTCATGG + Intronic
1143697529 17:8631086-8631108 CGGCGATCCCGCGAGGCTGCGGG + Intergenic
1144586740 17:16491923-16491945 CGGGGGCCCGGCGCGGCGCCGGG + Exonic
1144783102 17:17817554-17817576 GTGGGACCCCACGTGGCTCCAGG + Intronic
1145258722 17:21342253-21342275 CTGGGAACCCTCTGGGCTCCAGG + Intergenic
1145317907 17:21745751-21745773 CAGGGAACCCTCTGGGCTCCAGG - Intergenic
1145765686 17:27456885-27456907 CGGGGACCAGGCTGGGCTCGAGG + Intronic
1146062109 17:29613032-29613054 CGGAGAACCCGCGGGGCCCTCGG + Intronic
1148332035 17:46818921-46818943 CCCGGACGCCGCGGGGCTTCGGG + Intronic
1148493419 17:48037666-48037688 CGGGGAGCCCTCGGGGCTGCGGG - Exonic
1148818327 17:50346322-50346344 CGGGGTCCTGGCGGGGCTGCGGG + Intronic
1149997109 17:61411213-61411235 CTGGGGCCCCGCGGAGCGCCGGG - Intergenic
1150433463 17:65137237-65137259 CCGGGACCCCGCGGAGCAGCAGG - Intergenic
1150538805 17:66075796-66075818 GGGGGTCCCCTCGGGGTTCCTGG - Intronic
1151499254 17:74478402-74478424 CGGGCACCCCAGGGGCCTCCAGG + Intronic
1151630756 17:75309330-75309352 CAGGGACGCCACAGGGCTCCAGG - Intergenic
1151780077 17:76240057-76240079 AGGGGGCCCCGCGGGTCTTCGGG - Intronic
1151787159 17:76280617-76280639 CTGGGACACAGCGTGGCTCCTGG + Intronic
1152130388 17:78472677-78472699 CGGGGACTCGGCTGGGGTCCAGG - Intronic
1152589278 17:81203460-81203482 TGGGGAGGCCGCGGGGCTGCGGG - Intronic
1152654803 17:81514610-81514632 CGGGGAACCCGGGGGTCTCGAGG - Intronic
1152690251 17:81714728-81714750 CGGGGCGCTCGCGGGGCTCGCGG + Intronic
1153226878 18:2906591-2906613 CGAGGACGCCGCGGGCCACCCGG - Intronic
1154169256 18:12038748-12038770 CTGGGACCACGCGGTGCCCCGGG + Intergenic
1155954016 18:31942459-31942481 CTGTGGCCCCGCGGTGCTCCGGG - Intronic
1156495994 18:37525385-37525407 CTGGGAGCCAGCGGTGCTCCTGG + Intronic
1158517002 18:58138956-58138978 CGTGGTCCCGGCAGGGCTCCAGG - Intronic
1158938359 18:62384959-62384981 CGGCGGCCCCGAGGGGCTGCGGG + Exonic
1160163191 18:76491227-76491249 TGGGGTCTGCGCGGGGCTCCGGG - Intronic
1160163523 18:76492181-76492203 CAGCAACCCCGCGGTGCTCCCGG + Intronic
1160499730 18:79395794-79395816 CCGGGCCCGCGCGGGGCCCCGGG - Intergenic
1160702176 19:512932-512954 AGGGGAACCCGCGCGGCTCTTGG - Intronic
1160732815 19:648999-649021 CCGGGCCCCCGAGGAGCTCCCGG - Intronic
1160853543 19:1206035-1206057 CGGGGGCTCCACGGGGCTCCCGG - Intronic
1160858428 19:1227600-1227622 CGGGCACCTGGCGGGGCTCCTGG - Exonic
1160903029 19:1438646-1438668 CGGGGATCACTCGCGGCTCCGGG - Intronic
1160967884 19:1754493-1754515 CGGGAGCGCCGCGGGGCTGCTGG + Exonic
1160987893 19:1848119-1848141 CGGGGACCCCGGGCGGGACCGGG + Intronic
1161042542 19:2117662-2117684 CGGGGAGCCCGCGGGGGCCGAGG - Intronic
1161068857 19:2250707-2250729 CGGGGGCCTGGCGCGGCTCCGGG + Exonic
1161170618 19:2810737-2810759 CCGGGACCCCGAGGATCTCCTGG - Exonic
1161215759 19:3094472-3094494 CGGGGACCCGGCGGCTCGCCAGG + Exonic
1161355995 19:3819955-3819977 AGGCGACCACCCGGGGCTCCAGG + Intronic
1161371584 19:3914971-3914993 GGGGGTCCCTGAGGGGCTCCAGG - Intronic
1161946387 19:7440064-7440086 CCGGGACCCGGCGCGGCGCCAGG - Exonic
1162124215 19:8490556-8490578 CGGGGACCTCCCGGGGCTGCGGG + Intronic
1163302799 19:16458267-16458289 CAGGCACCCCTCGAGGCTCCCGG + Intronic
1163417562 19:17195670-17195692 TGGGGACCCCTCAAGGCTCCAGG - Intronic
1163462769 19:17448704-17448726 GGGGGCGCCCGCGGGGCCCCGGG - Intronic
1163631443 19:18419769-18419791 CGGGCACCGCGCGGGGCACGTGG + Intronic
1164179578 19:22807263-22807285 CGAGGTCCCCGCGGGGAGCCCGG - Intergenic
1165155037 19:33781749-33781771 CGGGCACTCAGCGGGGGTCCAGG - Intergenic
1165906413 19:39197138-39197160 CGGGGAGCTCGGGGGCCTCCGGG - Exonic
1167171906 19:47839251-47839273 CGGGCACCCTGCGGCTCTCCTGG + Intronic
1168213645 19:54909569-54909591 TGGGGATCCCTCAGGGCTCCAGG - Intronic
1168293821 19:55369511-55369533 CGCCCACCCGGCGGGGCTCCTGG - Intronic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
1168649724 19:58085484-58085506 CTGGATCCCCGCGGGGCTCACGG + Intronic
924985221 2:264307-264329 CGTGGACCCCGCGGGGCTCAAGG + Intronic
925333584 2:3077084-3077106 CAGGGACCCCGCGAGCATCCAGG + Intergenic
925609439 2:5691788-5691810 CAGGGCCGCCGCGGGGCTACCGG + Intergenic
925931222 2:8709585-8709607 AGGGGACGCCCCTGGGCTCCAGG + Intergenic
929452629 2:42047687-42047709 CGGAGCCCCCGCGCGCCTCCTGG + Intergenic
929468682 2:42169585-42169607 CGGGGAAAGCGCCGGGCTCCGGG - Exonic
931645594 2:64418959-64418981 CAGGGTCCCTGCGTGGCTCCAGG + Intergenic
934678556 2:96266418-96266440 CAGGGTCCCCGCGGGGTTCCAGG - Exonic
935137614 2:100321679-100321701 CGCGGGGCGCGCGGGGCTCCGGG + Exonic
938727525 2:134120868-134120890 CGGGGCGCCCCCGGGCCTCCTGG - Intronic
943179355 2:184524095-184524117 TGGGGAGCCCTGGGGGCTCCCGG - Intergenic
945080859 2:206085491-206085513 CGGAGACCCCGGGGGACTCGAGG + Intronic
946308820 2:218871644-218871666 CGGGGAGCCCGCGGGGCCAGGGG - Exonic
946865520 2:224038841-224038863 CGGGTCCCGCTCGGGGCTCCCGG + Intronic
948205978 2:236163241-236163263 CGGGGGCGCCCCGGGGCTCAGGG + Intergenic
948208215 2:236173845-236173867 CTGGAACCCCCCGGGACTCCTGG + Intergenic
948845404 2:240680601-240680623 GGGGGACCAGGCGGGGCTTCAGG - Intronic
948848457 2:240694278-240694300 GGGGGACCAGGCGGGGCTTCAGG + Intronic
1169758880 20:9069314-9069336 CGGGGTCCCCGCTGGGCATCCGG - Intronic
1170745721 20:19097432-19097454 TGGGGCCCCCGCTGGGCTGCAGG + Intergenic
1174870237 20:54174426-54174448 CGGGGAGCCCGGGCGCCTCCCGG + Intergenic
1175399655 20:58693100-58693122 CGGGGCCTCCGCGGGCCGCCCGG - Intronic
1176521663 21:7829438-7829460 GGGCAACCCCGGGGGGCTCCTGG - Intronic
1178655683 21:34459450-34459472 GGGCAACCCCGGGGGGCTCCTGG - Intergenic
1179112772 21:38461603-38461625 TGGGGACCCCAGGGGGTTCCTGG - Intronic
1179659178 21:42863629-42863651 CGAGGACCCTGCGCTGCTCCTGG - Intronic
1179780095 21:43694080-43694102 CGGGGGCTGCGCTGGGCTCCCGG - Exonic
1180092882 21:45541995-45542017 CGGGGTCTCCGCGGGGGTCGCGG - Intronic
1180744414 22:18077980-18078002 CCGGGACGCCGCGCGGCTGCGGG + Exonic
1180801585 22:18634472-18634494 GGGGGACGGCGCGGGGCTCGCGG - Intergenic
1180852828 22:19030011-19030033 GGGGGACGGCGCGGGGCTCGCGG - Intergenic
1180950409 22:19718260-19718282 CGGGGGCGCGGCAGGGCTCCCGG + Intronic
1181220137 22:21360789-21360811 GGGGGACGGCGCGGGGCTCGCGG + Intergenic
1182299240 22:29328716-29328738 GAGGGACCAGGCGGGGCTCCAGG - Exonic
1182355599 22:29721075-29721097 GGGGGTCCCCGCAGGGCTGCAGG - Intronic
1183201207 22:36387120-36387142 GGGGGACCCGGCGGGGACCCGGG - Intronic
1183483326 22:38076504-38076526 CGGGGACCCAGGTGGGCTCCTGG - Intergenic
1183535279 22:38397828-38397850 CGCGGACCCCGAGGTGCGCCGGG - Intronic
1183577318 22:38700507-38700529 CGAGGCCCCCGCGCGGCTCGCGG - Exonic
1183744836 22:39686257-39686279 CGCGGCCCACGAGGGGCTCCGGG - Exonic
1184034108 22:41910490-41910512 CGGGGCCCCCGCGCGGCCCGCGG - Exonic
1184176374 22:42791851-42791873 CGGGGCCCCCGCGGACCTGCTGG - Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184727487 22:46355400-46355422 TGGGGACGCCGAGGGGCACCTGG - Intronic
1184730055 22:46366959-46366981 CGGGGACACCGCGGGACTGGGGG - Intronic
1184981628 22:48099773-48099795 CTGGAAGCCCGAGGGGCTCCCGG + Intergenic
1185038022 22:48489772-48489794 CAGGCGCCCCGCGGGCCTCCCGG + Intronic
1185278677 22:49960802-49960824 CGCGGTCCCCGCGGGCCTTCCGG + Exonic
1185313670 22:50170018-50170040 GGGCGGCCCTGCGGGGCTCCGGG - Intergenic
950480362 3:13239854-13239876 TGGGGGCCCCGAGGGGCTGCGGG + Intergenic
953436324 3:42880769-42880791 CGGGGGCCACGCAGGGCTGCCGG + Intronic
953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG + Intronic
954059104 3:48055108-48055130 CGGGGACCACGTGGGGAACCTGG + Intronic
954186259 3:48919104-48919126 CGGGGAGCGCCCGGGCCTCCCGG - Exonic
954717607 3:52534146-52534168 CGGGTACCCCCCGGGCCCCCGGG + Intronic
954886731 3:53881765-53881787 CGGGGGCTCCGCCTGGCTCCTGG + Intronic
955911497 3:63863667-63863689 CGGGGAGGCCGAGGGGTTCCCGG + Intronic
960702410 3:120451131-120451153 CGGGGAGCCCGCGGGAGTCCTGG + Exonic
961454766 3:127018494-127018516 CGAGGGCCACGCGGGACTCCAGG - Exonic
961536682 3:127575146-127575168 CGGCGCCCCCGCGTGGCTGCCGG - Intronic
963725203 3:148912002-148912024 TGGGGGCTCCGCTGGGCTCCAGG - Intergenic
968048151 3:195635438-195635460 GGGGGCGCCCGCGGGGGTCCGGG - Intergenic
968099253 3:195954182-195954204 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968306460 3:197654483-197654505 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968490102 4:885510-885532 TGGGGCCCCCGCAGGGCTGCTGG - Intronic
968568614 4:1327893-1327915 CGGGGGCCCTGCCAGGCTCCAGG - Intronic
968898205 4:3417488-3417510 CTGGGACCTCCCGGTGCTCCTGG - Exonic
969436754 4:7193162-7193184 CCGGGACACCGCGGGACACCCGG + Intronic
977693808 4:99946336-99946358 CGGGGGCCCCGCAGGCCTCCAGG + Intronic
980130410 4:128811737-128811759 CGGGGACCGCGTCGGGCTTCGGG - Intronic
985593216 5:775957-775979 CAGGGACCCCCAGGGGTTCCTGG - Intergenic
985859537 5:2459959-2459981 TGCAGACCCCGCAGGGCTCCAGG - Intergenic
985936958 5:3104792-3104814 CGGGGAGCCCGCAGGACTCCTGG - Intergenic
987303484 5:16617193-16617215 CGGGGACACCGCCCAGCTCCCGG - Intergenic
987303491 5:16617205-16617227 CGGTGTCCCCGGGGGGCTCTGGG + Intergenic
993502711 5:88680551-88680573 GGGGGCCCGCGCGGGGCTCCTGG + Intergenic
996738229 5:126776800-126776822 AGGGGTCCCCGCGGGGCGGCGGG + Intronic
997568069 5:134904862-134904884 CGGGGACCGCGCGCGCCTGCTGG + Intergenic
997870014 5:137498650-137498672 CGGGGACCCCGCGGCGGGCACGG + Intronic
998797523 5:145835505-145835527 CGTGGAGACCGCGGGGCCCCGGG - Intergenic
1001342628 5:170861928-170861950 CAGGGACCCCGCGGGCGTCTGGG + Exonic
1001522333 5:172403472-172403494 CCAGGACCCCGCTGGGCCCCAGG - Intronic
1001818703 5:174693063-174693085 AGGGGTCCCCGCTGGGCTCGGGG - Intergenic
1002066601 5:176654972-176654994 AGGGCACCCCGCAGCGCTCCCGG - Exonic
1002140550 5:177134687-177134709 CGGGGTCCGAGGGGGGCTCCTGG - Intronic
1003107452 6:3227417-3227439 TGGGGACCCCGAGGGGCTCTCGG + Intronic
1004561953 6:16760528-16760550 CGGGGACCGCGCGGGGGTAGCGG - Intronic
1006296926 6:33173889-33173911 CGGGGACCCCGAGGTGCCACTGG - Exonic
1007829522 6:44627731-44627753 CGTAGATCCCCCGGGGCTCCAGG - Intergenic
1008952104 6:57172491-57172513 CGCGGCGCCCGCGGGGCTCGGGG - Exonic
1010229464 6:73521668-73521690 CGGGGACCCCGAGGGGCTTGGGG + Intronic
1013170738 6:107634724-107634746 CGGGGGGCCCGGGGGGCTGCCGG - Exonic
1013230583 6:108158051-108158073 CTGGACCCCCGCGGGGCTTCGGG - Intronic
1013372443 6:109482931-109482953 CTGGGACCACCCGGGGCTGCGGG - Intronic
1013391500 6:109690512-109690534 CAGGGACTCCGCGGGGCTGTCGG + Intronic
1015965747 6:138693591-138693613 GGGGGACCCCGAGGGGCCCGGGG - Intergenic
1017093098 6:150779217-150779239 CGGGGACCCAGCCAGGCTCCAGG - Intronic
1018769050 6:166956366-166956388 CGGGCCCCGCGCCGGGCTCCGGG + Exonic
1018774213 6:166998864-166998886 CGGCGCCCCCCCGGGGCTGCAGG + Intergenic
1019328171 7:449563-449585 CAGGGACCCCGGGGAGCTCATGG - Intergenic
1019484736 7:1284341-1284363 AGGGGTCCCCGCGGAACTCCAGG - Intergenic
1019499125 7:1355643-1355665 CCTGGACCCTGCGAGGCTCCTGG + Intergenic
1019819668 7:3233147-3233169 CAGGAACCCTGCGTGGCTCCAGG - Intergenic
1020001926 7:4761137-4761159 CGGGGACCCCGGGGGCCATCTGG - Exonic
1020034995 7:4959238-4959260 CGGGGGCACGGGGGGGCTCCCGG + Intergenic
1022114815 7:27252197-27252219 CGGGGTCCTCACGAGGCTCCCGG - Intergenic
1022714925 7:32891210-32891232 CTCGGCGCCCGCGGGGCTCCCGG - Intronic
1023435068 7:40134274-40134296 CTGGGACCCCGCGGGGGACCTGG + Exonic
1023871693 7:44266718-44266740 GGGGTGCCCCGCGGGGGTCCTGG - Intronic
1025017176 7:55449183-55449205 CAGGGGACCCGCGGCGCTCCGGG - Intronic
1029640434 7:101816468-101816490 CGCGCACCCCGCGGGCCGCCGGG - Intronic
1033361318 7:140640668-140640690 CGGGGACCCCCAGGGGCTTGCGG - Exonic
1034257693 7:149733529-149733551 CGGGGACCTCGCTGGGCTCATGG + Exonic
1034344810 7:150379547-150379569 CGGGGGGCGCGCGGGGCTCGGGG - Intronic
1034450240 7:151133386-151133408 AGGAGGCCCAGCGGGGCTCCAGG + Intronic
1034468932 7:151245603-151245625 CGGGGAGCCCGGGGGGCCCATGG + Exonic
1034941257 7:155231781-155231803 GGGGGAACCCGCCCGGCTCCCGG - Intergenic
1035265075 7:157685788-157685810 CTGGGACCCAGCGGGGACCCGGG - Intronic
1035580594 8:737457-737479 CGGGGACTGTGCCGGGCTCCCGG - Intronic
1036664644 8:10730630-10730652 CGGGGACCCGGCGGCGGCCCGGG - Intronic
1037116674 8:15236807-15236829 CGGGGAACCCGCGGAGCGGCGGG + Intronic
1040543582 8:48380371-48380393 TCGGGACCCCCCGGGGCTGCGGG + Intergenic
1040859550 8:51984750-51984772 CGGGTTCCCCTTGGGGCTCCTGG - Intergenic
1041412774 8:57575054-57575076 CAGGAACTCAGCGGGGCTCCTGG - Intergenic
1043873828 8:85463791-85463813 CTGGCGCCCGGCGGGGCTCCGGG - Intergenic
1049396371 8:142402997-142403019 CGCGGCCCCCGCCGGGCTCCGGG + Intronic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049591608 8:143465334-143465356 CAGGGAGCCCGCAGGGCTGCAGG - Intronic
1049694709 8:143977504-143977526 CGACGACCCCTCTGGGCTCCCGG - Exonic
1055091074 9:72365131-72365153 CGGGGAAGCTGCGCGGCTCCCGG + Intronic
1055574406 9:77647564-77647586 CCTGCACCCCGCTGGGCTCCAGG + Intronic
1057313437 9:93955209-93955231 CGGGGCCCGCGCGGGGCTCTAGG + Exonic
1057432080 9:95004463-95004485 CAGTGGCCCCTCGGGGCTCCGGG - Intronic
1057481278 9:95447337-95447359 GGGGGTCCCTGCGGGGCTGCTGG + Exonic
1058070760 9:100598729-100598751 TGGGGACTGGGCGGGGCTCCAGG - Intergenic
1060583368 9:124771056-124771078 CGGGGGCTCGGCGGGGTTCCTGG - Exonic
1060661571 9:125408082-125408104 CGGGTACACCGCGGGACTCACGG + Intergenic
1060932598 9:127498174-127498196 TGGGGAGGCCCCGGGGCTCCAGG + Intronic
1061052134 9:128203293-128203315 GGGGGAGCCCGCGGCGCTGCGGG - Intronic
1061216028 9:129222518-129222540 CGGGGACCCCGCCGCACTGCAGG + Intergenic
1061809501 9:133154136-133154158 TGGGGACCCAGCGGGACCCCGGG + Exonic
1062050017 9:134442432-134442454 CACGGACCCCTCGGGGCTCTGGG + Intergenic
1062116587 9:134812629-134812651 CGAGGACCCTCCGGAGCTCCAGG + Exonic
1062265779 9:135685856-135685878 CGAGGACCCTCCGGGGCTCCTGG - Intergenic
1062290570 9:135792548-135792570 TGTGGCCCACGCGGGGCTCCTGG - Exonic
1062528049 9:136986114-136986136 GGGGGACCCGGAGGGGCGCCTGG - Intronic
1062648768 9:137564830-137564852 CGCTGTCCCCGGGGGGCTCCTGG - Intronic
1203782148 EBV:106549-106571 CGTTGACCACGGGGGGCTCCAGG + Intergenic
1203740703 Un_GL000216v2:175087-175109 CCGGGTCCCCGCAGAGCTCCGGG - Intergenic
1203744604 Un_GL000218v1:34956-34978 CGGGGACCCCAGGTGTCTCCTGG + Intergenic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1186509187 X:10117607-10117629 CGGGGACCCCGTGTGGCTGAAGG - Exonic
1187419633 X:19122780-19122802 CGGGGGCCCCGCAGCGCTCCTGG + Intergenic
1187669849 X:21657272-21657294 CGCGGGCCCCGCGGGACTCCTGG - Exonic
1190055486 X:47179002-47179024 CAGGGACCCCGCAGTGCCCCAGG - Intronic
1190114812 X:47619589-47619611 CCGGGACCGGGCGTGGCTCCGGG + Exonic
1192503535 X:71667888-71667910 CCGTCACCCCGTGGGGCTCCCGG - Intergenic
1195363224 X:104104896-104104918 CTGGGACACCGCTGGGCTGCCGG - Exonic
1195830606 X:109054439-109054461 CGGGGACACCGGGGGGCGCCGGG - Intergenic
1198215298 X:134549721-134549743 CGGTGGCCCCGCTCGGCTCCGGG + Intergenic
1198423986 X:136497033-136497055 CGGGGACCCCGCGGAGCTCAAGG + Intergenic