ID: 1082822845

View in Genome Browser
Species Human (GRCh38)
Location 11:57556251-57556273
Sequence GAGCCGAATCACACCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082822845_1082822847 8 Left 1082822845 11:57556251-57556273 CCTGCCTGGGTGTGATTCGGCTC 0: 1
1: 0
2: 1
3: 9
4: 64
Right 1082822847 11:57556282-57556304 ACTAGCCATGTGATCTAACTAGG 0: 2
1: 0
2: 0
3: 6
4: 105
1082822845_1082822848 12 Left 1082822845 11:57556251-57556273 CCTGCCTGGGTGTGATTCGGCTC 0: 1
1: 0
2: 1
3: 9
4: 64
Right 1082822848 11:57556286-57556308 GCCATGTGATCTAACTAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 68
1082822845_1082822850 13 Left 1082822845 11:57556251-57556273 CCTGCCTGGGTGTGATTCGGCTC 0: 1
1: 0
2: 1
3: 9
4: 64
Right 1082822850 11:57556287-57556309 CCATGTGATCTAACTAGGCCGGG 0: 1
1: 1
2: 0
3: 6
4: 57
1082822845_1082822851 21 Left 1082822845 11:57556251-57556273 CCTGCCTGGGTGTGATTCGGCTC 0: 1
1: 0
2: 1
3: 9
4: 64
Right 1082822851 11:57556295-57556317 TCTAACTAGGCCGGGCACGATGG 0: 1
1: 0
2: 9
3: 135
4: 1243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082822845 Original CRISPR GAGCCGAATCACACCCAGGC AGG (reversed) Intronic
901123947 1:6916210-6916232 GAGCTGAATCCAGCCCAGGCAGG - Intronic
902378353 1:16040964-16040986 AGACAGAATCACACCCAGGCTGG + Intergenic
903143737 1:21356286-21356308 CACCCCAATCACACACAGGCTGG - Intergenic
905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG + Intergenic
907333672 1:53687171-53687193 GAGCAGAACCAGAGCCAGGCAGG + Intronic
915923236 1:159994550-159994572 GAGCAGAGTCACAGGCAGGCAGG + Intergenic
919728711 1:200899773-200899795 GAGAAGAGTCAGACCCAGGCAGG + Intronic
922671305 1:227510299-227510321 AAGCCGACTCTCACCCAGGGTGG - Intergenic
1066673822 10:37866865-37866887 GAGTCTCCTCACACCCAGGCCGG + Intergenic
1071858645 10:89650438-89650460 GAGCTGCATCACTCCCAGGCTGG + Intergenic
1073818443 10:107233338-107233360 GAGCCGAAGCACCCACTGGCAGG + Intergenic
1076233025 10:128837923-128837945 AAGCCGAATCAAATCCAGGAGGG + Intergenic
1082822830 11:57556152-57556174 GAGTTGAATCACACCCAGGCAGG - Intronic
1082822845 11:57556251-57556273 GAGCCGAATCACACCCAGGCAGG - Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1089386352 11:118070774-118070796 GAACCGAGGCAAACCCAGGCAGG + Intergenic
1102762271 12:115398479-115398501 GAGCCAGATCACCCCCTGGCGGG + Intergenic
1104509138 12:129360328-129360350 GACCAGAAGCCCACCCAGGCTGG - Intronic
1104748069 12:131222179-131222201 GAGCCGTACCACAGTCAGGCTGG - Intergenic
1107410954 13:40158374-40158396 AAGCTGAATCACACCCAGAGAGG - Intergenic
1108186295 13:47891966-47891988 CACCCTAATCACCCCCAGGCAGG + Intergenic
1122721741 14:103726150-103726172 CAGCTGAAGCACACGCAGGCCGG - Intronic
1126440178 15:48679206-48679228 GAAACGCATCACACCCAAGCAGG + Intergenic
1130658162 15:85807700-85807722 GAGCCCTCTCTCACCCAGGCTGG - Intergenic
1132598273 16:762929-762951 GAGCCCCATCACTCCCTGGCTGG - Intronic
1135968083 16:27052180-27052202 GAGCCGAATCACTGCCGTGCTGG + Intergenic
1139748019 16:69089986-69090008 GAGCCAAATCCCACCAAGGGAGG - Intergenic
1143691112 17:8566807-8566829 GAGTTGAAACACACCCTGGCAGG + Intronic
1144158043 17:12527345-12527367 GAGACGGATGTCACCCAGGCTGG + Intergenic
1147861480 17:43526455-43526477 AAGCCAAATCACGTCCAGGCGGG - Intronic
1151648888 17:75453210-75453232 GTGCAGAATCACACACAAGCAGG - Intronic
1152162270 17:78676215-78676237 CAGAAGAAACACACCCAGGCAGG + Intronic
1152645635 17:81467369-81467391 GAGCCGGATGAGGCCCAGGCCGG + Intergenic
1164699595 19:30275191-30275213 GAGCCTAACCACACTCAGGATGG - Intronic
1167148420 19:47695635-47695657 GGGCAGAATGACACCCAGACAGG + Intronic
1167249853 19:48393985-48394007 GAGCCCCACGACACCCAGGCAGG - Intergenic
932576207 2:72963700-72963722 GAGCCAACTCAGACCCAGCCTGG + Intronic
933847663 2:86338270-86338292 GAGCTGAATCAAACCAAGGCAGG - Intergenic
936062555 2:109305033-109305055 GAACCGCAACAAACCCAGGCTGG - Intronic
940819759 2:158339794-158339816 AAGCTCAGTCACACCCAGGCTGG - Intronic
947541352 2:230982004-230982026 GAGGCGACTCACACCCATGCAGG + Intergenic
1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG + Intronic
1171573575 20:26276846-26276868 GAGCCGACTCCCACCAAGGGAGG - Intergenic
1173582098 20:44154660-44154682 CAGCCTCTTCACACCCAGGCAGG - Intronic
1183782129 22:40005762-40005784 GAGCCCAATTCCACCCAGCCAGG - Intronic
1184465112 22:44664374-44664396 CAGCAGAAACACACACAGGCTGG + Intergenic
1185045684 22:48527667-48527689 AAGCCGCATCCCACCCAGGCTGG + Intronic
1185130109 22:49034067-49034089 GAGCTGAATGACAGCCAGACAGG - Intergenic
952967215 3:38628757-38628779 GAGCCGAATAAGACCCCGTCTGG - Intronic
953117993 3:40011592-40011614 GAGCTTAATCACAACAAGGCAGG - Intronic
957679145 3:83409001-83409023 GAGTCTCATCACACCCAGGCTGG + Intergenic
961685286 3:128625701-128625723 GAGCCTAGACTCACCCAGGCTGG + Intronic
961812406 3:129529488-129529510 GTGCTGAGTCAGACCCAGGCTGG + Intronic
966594660 3:181714803-181714825 GAGCCAAATCAGAACCAGGTTGG + Intergenic
967186357 3:186948072-186948094 GAGCGGATTCTCACCCAGGCAGG - Intronic
968297724 3:197590556-197590578 CAGCCGAATCTCACCCATGCAGG + Intergenic
986504702 5:8437112-8437134 CAGCCAAATAACAGCCAGGCTGG - Intergenic
995243399 5:109910999-109911021 GAGCCAACTCTCACCCTGGCTGG - Intergenic
1002303585 5:178271036-178271058 AAGCCGAATCACACCAGGGTGGG + Intronic
1004404837 6:15323351-15323373 GTGCTGTAGCACACCCAGGCTGG - Intronic
1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG + Exonic
1006677830 6:35776809-35776831 GTCCGGAACCACACCCAGGCGGG + Intronic
1016013154 6:139159192-139159214 GAGCTGAGTCACATCCAGGCAGG + Intronic
1018931114 6:168241091-168241113 GAGCTGAATCACATCCACTCAGG + Intergenic
1019339901 7:504059-504081 GAGACCAATCACACCCACCCAGG + Intronic
1025284136 7:57649001-57649023 GAGCCGACTCCCACCAAGGGAGG + Intergenic
1033020325 7:137718279-137718301 GAGGAGAATGACACCCAGGGAGG + Intronic
1034216429 7:149410380-149410402 CAGCCCAATCAGACACAGGCAGG - Intergenic
1034450024 7:151132280-151132302 GAGCAGCCTCCCACCCAGGCAGG - Intronic
1043164104 8:76881855-76881877 GAGGCCACTCACACTCAGGCTGG + Intergenic
1049407965 8:142460148-142460170 GAGCCTTCTCACACCAAGGCAGG - Intronic
1049540679 8:143207481-143207503 GGGCAGCATCTCACCCAGGCTGG + Intergenic
1053513906 9:38713054-38713076 GAGCCCACTCACAACCTGGCAGG - Intergenic
1194888852 X:99353426-99353448 GAGCCAGCTCACACCCAGGCAGG + Intergenic
1198057074 X:133005996-133006018 GAGCTGAATCCCATCCAGTCAGG - Intergenic