ID: 1082822851

View in Genome Browser
Species Human (GRCh38)
Location 11:57556295-57556317
Sequence TCTAACTAGGCCGGGCACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1388
Summary {0: 1, 1: 0, 2: 9, 3: 135, 4: 1243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082822844_1082822851 22 Left 1082822844 11:57556250-57556272 CCCTGCCTGGGTGTGATTCGGCT 0: 1
1: 0
2: 2
3: 8
4: 97
Right 1082822851 11:57556295-57556317 TCTAACTAGGCCGGGCACGATGG 0: 1
1: 0
2: 9
3: 135
4: 1243
1082822846_1082822851 17 Left 1082822846 11:57556255-57556277 CCTGGGTGTGATTCGGCTCTGAC 0: 1
1: 0
2: 2
3: 6
4: 70
Right 1082822851 11:57556295-57556317 TCTAACTAGGCCGGGCACGATGG 0: 1
1: 0
2: 9
3: 135
4: 1243
1082822842_1082822851 25 Left 1082822842 11:57556247-57556269 CCACCCTGCCTGGGTGTGATTCG 0: 1
1: 1
2: 0
3: 11
4: 204
Right 1082822851 11:57556295-57556317 TCTAACTAGGCCGGGCACGATGG 0: 1
1: 0
2: 9
3: 135
4: 1243
1082822845_1082822851 21 Left 1082822845 11:57556251-57556273 CCTGCCTGGGTGTGATTCGGCTC 0: 1
1: 0
2: 1
3: 9
4: 64
Right 1082822851 11:57556295-57556317 TCTAACTAGGCCGGGCACGATGG 0: 1
1: 0
2: 9
3: 135
4: 1243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082822851 Original CRISPR TCTAACTAGGCCGGGCACGA TGG Intronic
900259387 1:1716524-1716546 TTTCACGAGGCCGGGCACGGTGG + Intronic
900273995 1:1811405-1811427 ACAAACTAGGCCGGGCACAGTGG + Intronic
900635157 1:3659965-3659987 TCTGACTAGGCTGGGCACAGTGG - Intronic
900673796 1:3871575-3871597 TCTGCCTTGGCCGGGCACGGTGG - Intronic
901249541 1:7765738-7765760 GCTAAATAGGCCGGGCGCGGTGG + Intronic
901408149 1:9063980-9064002 TGTAAATAGGCCGGGCGCGGTGG - Intronic
901736444 1:11315388-11315410 TCTCACCAGGCCAGGCACGGAGG + Intergenic
901991866 1:13121786-13121808 TATAACAAGGCCAGGCACGGTGG - Intergenic
902100585 1:13984295-13984317 TCCAAATAGGCCGGGCGCGGTGG - Intergenic
902224317 1:14987205-14987227 TCTCTCTGGGCCGGGCACGGTGG + Intronic
902317359 1:15632287-15632309 GCAAAATAGGCCGGGCACGGTGG + Intronic
902345401 1:15813275-15813297 TCTAAGTAGGCCGGGCGCAGTGG + Intergenic
902825183 1:18968320-18968342 TCTAAGTTGGCCAGGCACGGTGG - Intergenic
902946285 1:19842359-19842381 TCTACCTAGGCCAGGCACAGTGG + Intergenic
903011564 1:20334521-20334543 TAGAGATAGGCCGGGCACGATGG + Intronic
903098929 1:21010157-21010179 TGTAACAAGGCCTGGCACGATGG + Intronic
903196634 1:21694283-21694305 TCTATCAAGGCCGGGCGCGGTGG + Intronic
903240405 1:21978892-21978914 TTAAATTAGGCCGGGCACGGTGG + Intronic
903594472 1:24483685-24483707 TCTAATTTGGCCGGGCACGGTGG + Intergenic
903756183 1:25662772-25662794 TATATTTAGGCCGGGCACGGTGG + Intronic
903783975 1:25844384-25844406 TCACACTTGGCCGGGCACAATGG - Intronic
903934349 1:26884691-26884713 TATAACTGGGCCAGGCACGGTGG + Intronic
904257407 1:29263884-29263906 TCTGAGTAGGCCGGGCATGGTGG + Intronic
904291895 1:29491761-29491783 ACTGAATAGGCCGGGCACGGTGG - Intergenic
904525951 1:31134032-31134054 TTTATTCAGGCCGGGCACGATGG + Intergenic
904720446 1:32503697-32503719 TATAATTAGGCCAGGCACGGTGG + Intronic
904760815 1:32803417-32803439 GCTAAATAGGCCGGGCATGGTGG - Intronic
904764048 1:32828711-32828733 TTTAATTAGGCCGGGCGCGGTGG + Intronic
904816024 1:33199728-33199750 AATATCTAGGCCGGGCATGATGG + Intergenic
905082552 1:35337069-35337091 TCTTTCTGGGCCGGGCACGGTGG + Intronic
905348284 1:37326830-37326852 TCAAACTAGGCCAGGCATGGTGG + Intergenic
905718399 1:40174083-40174105 TGTGACCTGGCCGGGCACGATGG + Intronic
906101523 1:43266861-43266883 TATAATTAGGCCGGGCACGGTGG - Intronic
906222770 1:44095186-44095208 TATAAATAGGCCGGGCATGGTGG - Intergenic
906456169 1:45999017-45999039 TCTAAGTAGGCCGGGCACGGTGG - Intronic
906658709 1:47567325-47567347 TGTTACAAGGCCGGGCACGGTGG + Intergenic
907061412 1:51429936-51429958 TCTGTCTTGGCTGGGCACGATGG - Intronic
907068420 1:51510875-51510897 TGTATCTAGGCCGGGCACGATGG + Intronic
907217575 1:52878649-52878671 TCAAACTCGGCCAGGCACGGTGG + Intronic
907239401 1:53072771-53072793 TCTAACTAGGCCGGGCGCGGTGG + Intronic
907363031 1:53935972-53935994 TCTAACTAGGCCGGGCGCGGTGG + Intronic
908076509 1:60525623-60525645 TCAAAATAGGCCAGGCACGATGG + Intergenic
908126454 1:61035544-61035566 TATAATGAGGCCGGGCACGGTGG + Intronic
908341406 1:63183916-63183938 AATAAATAGGCCGGGCACGGTGG + Intergenic
908378453 1:63571384-63571406 TATCACTAGGCCGGGCACGGTGG + Intronic
908425415 1:64002409-64002431 TCGAACCAGGCCGGGCGCAATGG - Intronic
908502686 1:64759801-64759823 TGAAAATAGGCCGGGCACGGTGG - Intronic
908618784 1:65952391-65952413 TATAATTAGGCCAGGCGCGATGG + Intronic
908997661 1:70176986-70177008 TAAAACTAGGCCAGGCACGGTGG + Intronic
909156677 1:72087130-72087152 TATGACTAGGCCGGGCACAGTGG + Intronic
909686866 1:78359018-78359040 TCTATCTTGGCCGGGCGCGGTGG - Intronic
909914518 1:81300764-81300786 TCTACCTTGGCCGGGCGCGGTGG - Intergenic
910043877 1:82888312-82888334 GCTAACTTGGCCGGGCGCGGTGG - Intergenic
910219274 1:84874038-84874060 TCTAAAGAGGCTGGGCACCATGG - Intronic
910290059 1:85591214-85591236 AATAACTAGGCCAGGCATGATGG + Intergenic
910521195 1:88124166-88124188 TTTAAGGAGGCCGGGCACGGTGG - Intergenic
910978332 1:92932151-92932173 TCCAACTAGGCTGGGCACAGTGG + Intronic
911621046 1:100066700-100066722 TTTAAATAGGCCGGGCATGGTGG + Intronic
911643738 1:100316453-100316475 TCAAACTTGGCCAGGCACAATGG - Intergenic
912245594 1:107958971-107958993 TATATCTAGGCCGGGCACAGTGG + Intronic
912470798 1:109905497-109905519 CCTTACTCGGCCGGGCACGGTGG - Intergenic
912850612 1:113120795-113120817 TCTCAGTAGGCCGGGCACAGTGG - Intronic
913102656 1:115583703-115583725 GCTAACTAGGCCAGGCACGGTGG - Intergenic
913534828 1:119761476-119761498 GCAAGCTAGGCCGGGCACGGTGG + Intronic
914252057 1:145929646-145929668 TCGAACTCGGCCGGGCGCGGTGG - Intergenic
914348031 1:146816476-146816498 TTGAACTAGGCCGGGCATGGTGG + Intergenic
914738620 1:150443716-150443738 TGTAACTAGGCTGGGCGCGGTGG + Intronic
914855151 1:151345320-151345342 TTTGACAAGGCCGGGCACGGTGG + Intronic
914882898 1:151561283-151561305 TTTAAAAAGGCCGGGCACGGTGG - Intronic
915337749 1:155156865-155156887 TAAAAACAGGCCGGGCACGATGG + Intergenic
915407688 1:155673872-155673894 TCAAAATAGGCCGGGCGCGGTGG + Intronic
915411278 1:155702681-155702703 GTTGACCAGGCCGGGCACGATGG + Intronic
915480918 1:156184289-156184311 ACTAAATAGGCCGGGCACAGTGG - Intergenic
915548600 1:156618490-156618512 TTTAAAAAGGCCGGGCACGGTGG + Intergenic
915918535 1:159956830-159956852 TTAAACTAGGCCAGGCACGGTGG + Intergenic
916041532 1:160965636-160965658 TATGAATGGGCCGGGCACGATGG + Intergenic
916098068 1:161368941-161368963 TATATCCAGGCCGGGCACGGTGG + Exonic
916762948 1:167833456-167833478 TCAACCTGGGCCGGGCACGGTGG + Intronic
917107619 1:171509170-171509192 TCAAATTGGGCCGGGCACGGTGG - Intronic
917333392 1:173905430-173905452 TCTCAGTAGGCCGGGCACGGTGG + Intronic
917873105 1:179259505-179259527 ACAAAGTAGGCCGGGCATGATGG - Intergenic
918226383 1:182486960-182486982 TATGACTAGGCCGGGCATGGTGG - Intronic
919006258 1:191902645-191902667 GAGAACTAGGCCGGGCATGATGG - Intergenic
919218276 1:194589444-194589466 TCACAGTAGGCCGGGCATGATGG - Intergenic
919256789 1:195136020-195136042 TATAAATAGGCCAGGCACGGTGG - Intergenic
919922252 1:202173500-202173522 GCACACAAGGCCGGGCACGATGG - Intergenic
919941269 1:202288088-202288110 TCAATCTAGTCCAGGCACGATGG + Intronic
920345986 1:205305999-205306021 TAGAACTAGGCCGGGCACAGTGG - Intronic
920362220 1:205426856-205426878 TCTAGCAAGGCAGGGCAGGATGG + Intronic
921411976 1:214845564-214845586 ATTGACTAGGCCGGGCACGGTGG + Intergenic
921710470 1:218368422-218368444 GCTGAATAGGCCGGGCACGGTGG - Intronic
922279113 1:224106125-224106147 TCTAACCTGGCCGGGCGCGATGG + Intergenic
922438327 1:225628621-225628643 TGCAACTAGGCCGGGCACAGTGG + Intronic
922458975 1:225800301-225800323 TTTAAATAGGCCAGGCACGGTGG + Intergenic
922911990 1:229225842-229225864 TCTAAGCAGGCCAGGCACGGTGG + Intergenic
922946090 1:229515474-229515496 TAAAACCAGGCCGGGCACGGTGG + Intergenic
923104743 1:230845394-230845416 TAAAAATAGGCCAGGCACGATGG + Intronic
923338451 1:232989165-232989187 GCTCACTCGGCCGGGCACGGTGG + Intronic
923829320 1:237537600-237537622 TATATTTAGGCCGGGCACGGTGG - Intronic
923933822 1:238737205-238737227 TATAAATAGGCCGGGCATGGTGG + Intergenic
924686367 1:246294884-246294906 GCTAATTGGGTCGGGCACGATGG - Intronic
1063406539 10:5801238-5801260 GGTGACTAGGCTGGGCACGATGG - Intronic
1063677541 10:8154775-8154797 CATTACTAGGCCGGGCACGATGG + Intergenic
1063762420 10:9095237-9095259 TATGACTAGGCCGGGCGCGGTGG - Intergenic
1064056105 10:12098881-12098903 ACTAACTTGGCCAGGCACGGTGG + Intronic
1064156053 10:12904177-12904199 GCTCACTAGGCCGGGCATGGTGG + Intronic
1064374353 10:14782369-14782391 TCTAGATAGGCCGGGCGCGGTGG + Intergenic
1064414883 10:15140409-15140431 TGTGAATAGGCTGGGCACGATGG - Intronic
1064644591 10:17448086-17448108 TCAAACTAGGCCAGGCACAGTGG - Intronic
1064644868 10:17450727-17450749 TCCAAGTAGGCCGAGCACGGAGG - Intronic
1064713154 10:18146908-18146930 TAAAATTAGGCCGGGCACGGTGG - Intronic
1065043789 10:21726036-21726058 CATAACTAGGCCGGGCGCGGTGG - Intronic
1065056048 10:21843677-21843699 TCTAAGTAGGCCAGGCACAGTGG - Intronic
1065233983 10:23628192-23628214 TAGAACTAGGCTGGGCGCGATGG + Intergenic
1065262900 10:23944135-23944157 AATAAGTAGGCCGGGCACGGTGG + Intronic
1065501813 10:26390841-26390863 TAAAACTAGGCCTGGCAAGATGG + Intergenic
1065537605 10:26730197-26730219 TCCAACTAGGCTGGGCGCGGTGG - Intronic
1065546530 10:26827198-26827220 TCAAACCAGGCCGGGCACGGTGG - Intronic
1065732891 10:28725408-28725430 TCAAAATTGGCTGGGCACGATGG - Intergenic
1065911212 10:30307557-30307579 TCTAACTTGGCCGGGCGCGGTGG - Intergenic
1065916681 10:30358977-30358999 TATAAATAGGCCGGGCGCGGTGG + Intronic
1066063877 10:31748632-31748654 ACTAGCTAGGCCGGGCATGGTGG + Intergenic
1066345529 10:34581519-34581541 CCTAAATAGGCCGGGCGCGGTGG - Intronic
1066415899 10:35221644-35221666 TATAACCAGGCTGGGCACGGTGG + Intergenic
1066425963 10:35308102-35308124 ACTACCTCGGCCGGGCACGGTGG - Intronic
1066610881 10:37247582-37247604 AATAACTAGGCCGGGCACAGTGG + Intronic
1068063403 10:52098521-52098543 TGTAAATAGGCCGGGCGCGGTGG + Intronic
1068069581 10:52179972-52179994 TCTATTTAGGCTGGGCACGGTGG - Intronic
1068699290 10:60002859-60002881 TAAAAATAGGCCGGGCACGGTGG - Intergenic
1069433994 10:68363465-68363487 ACGAACTAGGCCGGGCGCGGTGG - Intronic
1069894090 10:71669846-71669868 TATTACTAGGCCGGGCAAGGTGG + Intronic
1070075408 10:73130173-73130195 TTTAACTCGGCCGGGCACAGTGG + Intronic
1070076073 10:73137486-73137508 TTTAATGAGGCCGGGCACGGTGG + Intronic
1070127415 10:73633439-73633461 TCAAAGCAGGCCGGGCACGGTGG + Intronic
1070227634 10:74527072-74527094 TCCAAAGAGGCCGGGCACGGTGG + Intronic
1070302653 10:75215637-75215659 TCTATATAGGCCGGGCGCGGTGG - Intronic
1070451846 10:76566997-76567019 TCAAAGTCGGCCGGGCACGGTGG + Intergenic
1070750425 10:78960934-78960956 TATACCTGGGCAGGGCACGAGGG + Intergenic
1070846621 10:79527647-79527669 CATAAATAGGCCGGGCACGGTGG + Intergenic
1070861127 10:79663203-79663225 TTCAACTCGGCCGGGCACGGTGG - Intergenic
1070864556 10:79699728-79699750 CATAACTGGGCCGGGCACGGTGG - Intergenic
1070927172 10:80232621-80232643 AATAAATAGGCCGGGCACGGTGG - Intergenic
1071540222 10:86476076-86476098 ACTGACTAGGCCGGGCACGGTGG + Intronic
1071631460 10:87221958-87221980 CATAACTGGGCCGGGCACGGTGG - Intergenic
1071643061 10:87334527-87334549 TTTAACTCGGCCGGGCGCGGTGG + Intergenic
1072168648 10:92838785-92838807 CCTACCTAGGCCAGGCACGGTGG + Intronic
1072345204 10:94498104-94498126 AGTAACTAGGCCGGGCACGGTGG - Intronic
1072353076 10:94577637-94577659 TTAAACCAGGCCGGGCATGAAGG + Intronic
1072356368 10:94615544-94615566 ATAAACTAGGCCGGGCACGGTGG - Intergenic
1072568235 10:96635918-96635940 GAAAACTAGGCCGGGCACGGTGG + Intronic
1073107697 10:101041804-101041826 GTTATCTAGGCCGGGCACGGTGG - Intergenic
1073245771 10:102088869-102088891 TCATGCTAGGCCGGGCACGGTGG + Intergenic
1073297187 10:102448106-102448128 ACTAAGCAGGCCGGGCACGGTGG + Intergenic
1073360742 10:102896519-102896541 ATTTACTAGGCCGGGCACGGTGG + Intronic
1073732101 10:106301060-106301082 TTTAAGTAGGCTGGGCACGGTGG - Intergenic
1073993744 10:109292892-109292914 TGTAAATAGGCCGGGCGCGATGG - Intergenic
1073999652 10:109357483-109357505 TAAAAATAAGCCGGGCACGATGG + Intergenic
1075049031 10:119168688-119168710 TGTCTCTAGGCCGGGCACGGTGG + Intronic
1075109013 10:119562672-119562694 TCCATCAGGGCCGGGCACGATGG + Intergenic
1075208003 10:120463311-120463333 TGTTTCTAGGCCGGGCACGGTGG - Intronic
1075857624 10:125643454-125643476 AAAAATTAGGCCGGGCACGATGG + Intronic
1075887474 10:125913835-125913857 TCTTGACAGGCCGGGCACGAAGG - Intronic
1076397469 10:130151211-130151233 TCTACCAGAGCCGGGCACGATGG - Intronic
1076664814 10:132080805-132080827 TATAACTTGGCCGGGCATGGTGG - Intergenic
1076739171 10:132473330-132473352 TTTAAATTGGCCGGGCACGGTGG - Intergenic
1077644982 11:3915682-3915704 AAAAACTAGGCCGGGCACGGTGG - Intronic
1077645942 11:3924103-3924125 TCTAAATAGGCCAGGCATGGTGG - Intronic
1077730687 11:4726187-4726209 TTTTACTAGGCCGGGCATGGTGG + Intronic
1077899657 11:6478466-6478488 TCTGATTAGGCTGAGCACGAAGG + Intronic
1078274200 11:9827123-9827145 ACTAAGTAGGCCGGGCACGGTGG - Intronic
1078731783 11:13981611-13981633 TCTAGCTCGGCCGGGCACGGTGG - Intronic
1078871139 11:15346159-15346181 TTTAAAAAGGCCGGGCACGGTGG + Intergenic
1078985320 11:16588739-16588761 TCACACTAGGCCAGGCACCATGG + Intronic
1079169576 11:18079782-18079804 TCAAATTAGGCTGGGCACGGTGG + Intronic
1080301615 11:30791097-30791119 AAAAACTAGGCCGGGCACGGTGG - Intergenic
1080430160 11:32190491-32190513 TCAGACTGGGCCGGGCACGGTGG - Intergenic
1080533134 11:33196218-33196240 TCTATTTAGGCCAGGCATGATGG + Intergenic
1080547843 11:33338517-33338539 AATAACTAGGCCGGGCACGGCGG - Intronic
1080610300 11:33898399-33898421 CCTCAATAGGCCGGGCACGAAGG + Intergenic
1081015948 11:37880837-37880859 ACAAACTAGGCCGGGCGCGGTGG - Intergenic
1081016076 11:37882722-37882744 ACAAACTAGGCCAGGCACGGTGG + Intergenic
1081101166 11:39004703-39004725 TGAAAATAGGCCGGGCACGGTGG + Intergenic
1081832537 11:46125963-46125985 TTTAATTAGGCCGGGCGCGGTGG + Intergenic
1082015912 11:47486693-47486715 TCTGCCTAGGCCAGGCACGGTGG - Intronic
1082060864 11:47858892-47858914 TTTAAGGAGGCCGGGCACGGTGG - Intergenic
1082714942 11:56600623-56600645 TGTAATTAGGCGGGGCACGGTGG - Intergenic
1082822851 11:57556295-57556317 TCTAACTAGGCCGGGCACGATGG + Intronic
1082830878 11:57616344-57616366 TTTCACTAGGCCGGGCACAGTGG - Intergenic
1083153252 11:60806911-60806933 TGAAAGTAGGCCGGGCACGGTGG - Intergenic
1083562717 11:63686181-63686203 TGTAACTTGGCCGGGCACGGTGG + Intronic
1084396237 11:68912415-68912437 TGTAACTGGGCCGGGCACAGTGG - Intronic
1084783969 11:71430865-71430887 TAAAACTAGGCTGGGCACGGTGG + Intronic
1084875236 11:72126821-72126843 TACAATTAGGCCGGGCACCATGG + Intronic
1084925617 11:72508947-72508969 GCTGAATAGGCCGGGCACGATGG + Intergenic
1085028152 11:73251929-73251951 AATAATTAGGCCGGGCACGGTGG + Intergenic
1085107123 11:73854572-73854594 TGCAACTAGGCCAGGCACGGTGG - Intronic
1085119851 11:73960053-73960075 TAAAAATAGGCCGGGCACGGTGG - Intronic
1085233561 11:74993489-74993511 TCTAACCAGGCCGGGCGTGGTGG - Intronic
1085274261 11:75288148-75288170 ATTAATTAGGCCGGGCACGGTGG - Intronic
1085327351 11:75617227-75617249 TCAAACTAGGCTGGGCACCGTGG + Intronic
1085478019 11:76799758-76799780 TCCCTCAAGGCCGGGCACGATGG + Intergenic
1085584011 11:77683414-77683436 TATGACTAGGCCGGGCGCGGTGG + Intronic
1085914095 11:80863751-80863773 TCTCTCTAGGCCGGGCACAGTGG - Intergenic
1086105461 11:83142353-83142375 TCAGAATAGGCCAGGCACGATGG + Intergenic
1086114550 11:83233968-83233990 TCTAATGAGGCCGGGCACCGTGG - Intronic
1086207811 11:84281006-84281028 GTTATCTAGGCCGGGCACGGTGG - Intronic
1086350305 11:85937375-85937397 TTTAATTAGGCCGGGCATGGTGG + Intergenic
1086362491 11:86073222-86073244 TAAGACTTGGCCGGGCACGATGG - Intergenic
1086385778 11:86305663-86305685 AATAACTAGGCCAGGCACGGTGG - Intronic
1086392463 11:86379381-86379403 TATAACTGGGCCTGGCACGGTGG - Intronic
1086582623 11:88416802-88416824 GTCAACTAGGCCGGGCGCGATGG + Intergenic
1087255870 11:95952206-95952228 TCTATCTGGGCCGGGCATGTTGG - Intergenic
1087452225 11:98339594-98339616 TCTTGATAGGCCGGGCATGATGG + Intergenic
1087510410 11:99085330-99085352 GGTTACTAGGCCGGGCACGGTGG - Intronic
1087729473 11:101761660-101761682 TATGCCTGGGCCGGGCACGATGG - Intronic
1088092476 11:106058709-106058731 CCTAATTAGGCTGGGCACGGTGG - Intronic
1088314078 11:108489632-108489654 GCAAACTAGGCCGGGCATGGTGG + Intronic
1088437669 11:109833524-109833546 TGTATCTTGGCCGGGCACGGTGG + Intergenic
1088667051 11:112103507-112103529 GCTACCTTGGCCGGGCACGGTGG - Intronic
1089153810 11:116385389-116385411 CCTAACTGGGCCGGGCGCGGTGG + Intergenic
1089945973 11:122473963-122473985 ATTAACTAGGCCGGGCATGGTGG - Intergenic
1090296194 11:125590768-125590790 TCAAAGTAGGCCAGGCGCGATGG - Intergenic
1090816910 11:130306213-130306235 TAAAAGTAGGCTGGGCACGATGG + Intronic
1090931477 11:131301644-131301666 TCTAACTAGGCTAAGCAAGAGGG + Intergenic
1091459694 12:634544-634566 TGCAACTAGGCCGGGCGCGGTGG - Intronic
1091518480 12:1211433-1211455 TCAACTTAGGCCGGGCACGGTGG - Intronic
1091731719 12:2885860-2885882 TCAAAGTAGGCCGGGCGCGGTGG - Intronic
1091879689 12:3967124-3967146 TCTTTCTAGGCCGGGCGCGGTGG + Intergenic
1092806810 12:12231614-12231636 TCAAACTAAGCCGGGCACAGTGG + Intronic
1092898347 12:13035467-13035489 AATAAATAGGCCAGGCACGATGG - Intergenic
1093025484 12:14241514-14241536 TCTGACTAGGCCAGGTACGGTGG + Intergenic
1093233877 12:16582758-16582780 CAGAACTAGGCCGGGCACGGTGG + Intronic
1094003871 12:25726788-25726810 TCTATTTAGGCCGGGCGCGGTGG + Intergenic
1094068961 12:26391851-26391873 TCAGAATAGGCCGGGCACGGTGG - Intronic
1094200787 12:27792808-27792830 TGGAACCAGGCCGGGCACGGTGG - Intronic
1094601534 12:31913055-31913077 TCTAAGGAGGCCGGGCATGGTGG + Intergenic
1094630981 12:32173335-32173357 TCTGCCTGGGCCGGGCACGGTGG - Intronic
1094650150 12:32368405-32368427 TTTAAATAGGCCAGGCATGATGG + Intronic
1095514393 12:42990187-42990209 TATGACTAGGCCGGGCACGGTGG + Intergenic
1095732001 12:45516138-45516160 ACAAGCTAGGCCGGGCACGGTGG - Intergenic
1095744593 12:45643541-45643563 GATATCTAGGCCGGGCGCGATGG - Intergenic
1095762719 12:45858045-45858067 TCTAGCTAGGCCAGGCACGGTGG - Intronic
1096162640 12:49392762-49392784 TAGAAGTAGGCCGGGCGCGATGG + Intronic
1096294537 12:50372611-50372633 TAATACTAGGCCGGGCACGGTGG + Intronic
1096336040 12:50757280-50757302 GGTAAGTAGGCCGGGCACGGTGG - Intergenic
1096337694 12:50769215-50769237 TCTAAGTTGGCCGGGCACAGTGG + Intronic
1096357619 12:50955002-50955024 TATAATTAGGCCGGGCACAGTGG + Intronic
1096646028 12:53036397-53036419 AAAAACTAGGCCGGGCACGGCGG - Intronic
1096831724 12:54319752-54319774 TGCAACTAGGCCGGGCACAGTGG - Intronic
1096852177 12:54447473-54447495 GCTAATCAGGCCGGGCACGGTGG - Intergenic
1096998361 12:55854774-55854796 ATTAATTAGGCCGGGCACGGTGG + Intergenic
1097025167 12:56049685-56049707 AATAAATGGGCCGGGCACGATGG + Intergenic
1097048188 12:56203679-56203701 TCTTCATAGGCCGGGCACGGTGG - Exonic
1097065408 12:56316818-56316840 TATAATTAGGCCGGGCGCGGTGG - Exonic
1097121202 12:56733876-56733898 ACTAACTTGGCCAGGCACGGTGG - Intronic
1097256631 12:57681202-57681224 TCTAACTAGGCTGAGCACTGTGG - Intergenic
1097257681 12:57692876-57692898 TAAAAATAGGCCGGGCACGGTGG - Intergenic
1097559890 12:61189942-61189964 TCTATGTAGGCCGGGCACCGTGG + Intergenic
1097799581 12:63899083-63899105 TAGAACCAGGCTGGGCACGATGG + Intronic
1097819565 12:64114636-64114658 GCTAACCAGGCCAGGCACGGTGG - Intronic
1097897924 12:64844079-64844101 TCTAAGTAGGCTGGGCACAGTGG - Intronic
1098075453 12:66725002-66725024 TAGAAGTAGGCCAGGCACGATGG + Intronic
1098257838 12:68635740-68635762 CCTAAGTAGGCCAGGCACGCTGG - Intronic
1098272275 12:68780458-68780480 TGTGACTAGGCCAGGCAGGACGG - Exonic
1098302626 12:69069605-69069627 TATAACCAGGCCAGGCGCGATGG - Intergenic
1098560235 12:71864790-71864812 TGTAGGTAGGCCGGGCACGGTGG - Intronic
1098934426 12:76461722-76461744 ACTTACTATGCCGGGCACGGTGG - Intronic
1098960701 12:76737410-76737432 TGTATCTTGGCCGGGCACGGTGG + Intergenic
1098978521 12:76930107-76930129 TCTAAATTAGCCGGGCACGGTGG - Intergenic
1099731965 12:86516029-86516051 TTTAAATGGGCCGGGCGCGATGG - Intronic
1100070819 12:90715252-90715274 AGTAATTAGGCCGGGCACGATGG + Intergenic
1100307631 12:93365559-93365581 TATAAGTAGGCCGGGCATGGTGG - Intergenic
1100387542 12:94117930-94117952 TCTCTCTAGGCCGGGCACTATGG + Intergenic
1100485554 12:95022988-95023010 TATAACTTGGCCCGGCACAATGG - Intronic
1100531073 12:95462135-95462157 TCTTCCTAGGCCGGGCACAGTGG - Intergenic
1100707922 12:97221623-97221645 TCTAAATTGGCCGGGCACGGTGG - Intergenic
1100713621 12:97283339-97283361 TGCAACTCGGCCGGGCACGGTGG - Intergenic
1100975748 12:100121058-100121080 GCAAACTAGGCCGGGCACAGTGG + Intronic
1101111678 12:101492486-101492508 TCTTTCTAGGCCGGGCATGGTGG - Intergenic
1101301273 12:103485154-103485176 TGAAACTGGGCCGGGCACGGTGG - Intronic
1101891275 12:108717928-108717950 GAAAACTAGGCCGGGCACAATGG + Intronic
1102104164 12:110306324-110306346 TATCACTAGGCCGGGCGCGGTGG - Intronic
1102125127 12:110474400-110474422 TACTACTAGGCCGGGCACGGTGG + Intronic
1102326347 12:111988404-111988426 ACAAACAAGGCCGGGCACGGTGG + Intronic
1102552162 12:113699268-113699290 TACAATTAGGCCAGGCACGATGG - Intergenic
1102705948 12:114880545-114880567 TTTAAATAGGCCGGGCACAGTGG - Intergenic
1102899894 12:116628265-116628287 AATAAATAGGCCGGGCACGGTGG - Intergenic
1103101722 12:118181895-118181917 TTTATTCAGGCCGGGCACGATGG + Intronic
1103275190 12:119705377-119705399 TCAAATTAGTCCTGGCACGAAGG + Intronic
1103642835 12:122366022-122366044 AGTAAATAGGCCAGGCACGATGG + Intronic
1103653086 12:122448475-122448497 TAAAAATAGGCCGGGCACGGTGG - Intergenic
1103732212 12:123035376-123035398 TTTAACTGGGCCGGGCACAGTGG + Intronic
1103753603 12:123184783-123184805 ATTAAATAGGCCGGGCACGGTGG - Intronic
1104316164 12:127703863-127703885 TTTTACTGGGCCGGGCACGGTGG - Intergenic
1104531581 12:129576059-129576081 TCTATCTGGGCCGGGCGCGGTGG - Intronic
1104852884 12:131886461-131886483 GCTAACCAGGCCGGGCGCGGTGG + Intergenic
1104871177 12:131997541-131997563 ACAAAATAGGCCAGGCACGATGG - Intronic
1105489202 13:20871093-20871115 TGAAAATTGGCCGGGCACGATGG - Intronic
1105696083 13:22890026-22890048 TTGATCTAGGCCGGGCACGGTGG - Intergenic
1106946362 13:34832178-34832200 TCAGATTAGGCCGGGCACGGTGG + Intergenic
1107530951 13:41281847-41281869 TCTGCCCAGGCCGGGCACGGTGG + Intergenic
1107858844 13:44641949-44641971 TGTTACTAGGCCGGGCATGGTGG - Intergenic
1107887160 13:44883175-44883197 TCTTTCTAGGTCGGGCACGGTGG + Intergenic
1107937369 13:45356426-45356448 GCTAACTAGGCTGGGCACGGTGG - Intergenic
1108222455 13:48250330-48250352 TCTAAGTTGGCCGGGTACGGTGG + Intronic
1108387921 13:49918663-49918685 ACTAATTAGGCCAGGCACGGTGG - Intronic
1108425222 13:50292545-50292567 TGTAACTTGGCTGGGCACGGTGG + Intronic
1108502509 13:51081087-51081109 TATAAATGGGCCGGGCACGTAGG + Intergenic
1108621618 13:52190466-52190488 TATAATTAGGCCGGGCGCGGTGG + Intergenic
1108666479 13:52637108-52637130 TATAACTAGGCCAGGCACTGTGG - Intergenic
1108879475 13:55091931-55091953 TCATACTAGGCCGGGCACGATGG + Intergenic
1108901528 13:55415188-55415210 TTTACCTCGGCCGGGCACGGTGG + Intergenic
1109379349 13:61539577-61539599 TATACCTAGGCCGGGCGCGGTGG + Intergenic
1110050172 13:70887082-70887104 GCTAAATAGGCCGGGCGCGGTGG + Intergenic
1110226405 13:73124313-73124335 TCTGGCTAGGCCGGGCGCGGTGG + Intergenic
1110301577 13:73935274-73935296 CCAAAGTAGGCCGGGCACGATGG - Intronic
1110413993 13:75232516-75232538 TCAATCTAGGCCAGGCACGGTGG + Intergenic
1110519378 13:76457164-76457186 TCATTCTAGGCCGGGCACGGTGG + Intergenic
1110527666 13:76558057-76558079 CCTTACTAGGCCGGGCATGGTGG + Intergenic
1110565785 13:76956485-76956507 AATAATAAGGCCGGGCACGATGG - Intronic
1110673556 13:78210519-78210541 TAGAACTAGGCCAGGCACGGTGG - Intergenic
1110736488 13:78943154-78943176 TCAATCTTGGCCGGGCACGGTGG - Intergenic
1111229544 13:85325907-85325929 GCTAAATAGGCCGGGCGCGGTGG + Intergenic
1112085595 13:96028855-96028877 GCTCATTAGGCCGGGCACGGTGG + Intronic
1112403854 13:99100526-99100548 TAAAACTAGGCCGGGCACGGTGG + Intergenic
1112705774 13:102068269-102068291 GCAAACCAGGCTGGGCACGATGG + Intronic
1112852447 13:103723313-103723335 ACTAAATAGGCCGGGCGCGGTGG + Intergenic
1112892899 13:104260432-104260454 TGTCATTAGGCCGGGCACGGTGG + Intergenic
1112939195 13:104840699-104840721 AATAATTTGGCCGGGCACGATGG + Intergenic
1113233633 13:108243020-108243042 CCTTGCTAGGCCGGGCACGGTGG - Intergenic
1114144601 14:19959865-19959887 TCTACCTTGGCCGGGCGCGGTGG + Intergenic
1114561116 14:23591167-23591189 TCCAAGTAGGCCGGGCACAGTGG - Intergenic
1115272773 14:31572424-31572446 TCTAGCTAGGCCAGGCACAGTGG - Intronic
1115298010 14:31852383-31852405 TCAAAGTAGGCCCGGCACGGTGG + Intronic
1115418872 14:33169278-33169300 TCAGAGTGGGCCGGGCACGATGG + Intronic
1115490354 14:33952334-33952356 TGCAAATAGGCCGGGCACGGTGG - Intronic
1115683723 14:35771104-35771126 ACAAAATAGGCCGGGCACGGTGG + Intronic
1116817419 14:49597199-49597221 ATTAACTAGGCCGGGCGCGGTGG - Intronic
1116925020 14:50625628-50625650 TCATGCTAGGCCGGGCACGATGG + Intronic
1117019791 14:51558179-51558201 TTAAATGAGGCCGGGCACGATGG + Intronic
1117132440 14:52699399-52699421 TAAAAATAGGCCGGGCACGGTGG + Intergenic
1117165030 14:53024675-53024697 CTGAACTAGGCCAGGCACGATGG + Intergenic
1117204805 14:53430428-53430450 TCAAATAAGGCCGGGCACGGTGG - Intergenic
1117686226 14:58256139-58256161 AGTTACTAGGCCGGGCACGGTGG - Intronic
1117701090 14:58414448-58414470 AATAACTAGGCTGGGCACGGTGG + Intronic
1117739089 14:58797525-58797547 TTTTACTAGGCCTGGCACGGTGG + Intergenic
1118023189 14:61740350-61740372 TTTAACTAGGCCGGGCTCAGTGG - Intronic
1118107938 14:62681942-62681964 CCTAAGTAGGCCAGGCACGGTGG + Intergenic
1118108291 14:62686623-62686645 GCTAAATAGGCCGGGCACAGTGG + Intergenic
1118184761 14:63526880-63526902 TTTACCTAGGCCGGGCACAGTGG + Intronic
1118570548 14:67190508-67190530 TCAAAACAGGCCGGGCACAACGG - Intronic
1118801568 14:69194423-69194445 ACTGACTAGGCCGGGCGCGGTGG - Intronic
1119227619 14:72956206-72956228 TGTAACCAGGCCGGGCACGGTGG - Intronic
1119288260 14:73473925-73473947 AGTAACGAGGCCGGGCGCGATGG + Intergenic
1119307692 14:73620915-73620937 TCTCCCTGGGCCGGGCACGGTGG + Intergenic
1119404407 14:74388586-74388608 TCTGGCTAGGCTGGGCACGGTGG + Intergenic
1119561390 14:75592699-75592721 TCTGCCTAGGCCGGGCATGGTGG + Intronic
1119825202 14:77651927-77651949 ACAAACTAGGCTGGGCACGGTGG + Intergenic
1119983981 14:79115036-79115058 GCAAACTAGGCCAGGCACGGTGG + Intronic
1120247093 14:82020008-82020030 ACTACCTAGGCCGGGCGCGGTGG - Intergenic
1120303903 14:82742982-82743004 TCCAACTCGGCCGGGCATGATGG - Intergenic
1120517298 14:85485968-85485990 CCTATATAGGCCGGGCACGGTGG - Intergenic
1120851639 14:89177296-89177318 AGTAAAGAGGCCGGGCACGATGG - Intronic
1120919185 14:89739090-89739112 ACTATCTAGGCCGGGCGCGGTGG - Intergenic
1120990161 14:90368444-90368466 TGTAAATAGGCTGGGCACGATGG - Intergenic
1121029122 14:90643119-90643141 TGTAACTAGGCTGGGCACAGTGG + Intronic
1121197772 14:92089623-92089645 TCTAACAGGGCCGGGCGCGGTGG - Intronic
1121225096 14:92315875-92315897 TCAAAGCAGGCCGGGCACGGTGG + Intergenic
1121355544 14:93211257-93211279 AATAAATAGGCCGGGCACGGTGG + Intronic
1122208863 14:100162058-100162080 TATAAATAGGCCGGGCACGGTGG + Intergenic
1122343125 14:101041688-101041710 CCTACCTTGGCCGGGCACGGTGG + Intergenic
1122711704 14:103663365-103663387 GCTAAATAGGCCGGGCGCGGTGG - Intronic
1122712445 14:103669147-103669169 TGTAGTGAGGCCGGGCACGATGG + Intronic
1122876642 14:104669405-104669427 ACTCACTAGGCCAGGCACGGTGG + Intergenic
1122928289 14:104920513-104920535 AATAAATAGGCCGGGCACGGTGG - Intergenic
1123205695 14:106711030-106711052 TCTCTCTAGGCCGGGCGCGGTGG - Intergenic
1123210769 14:106758447-106758469 TCTCTCTAGGCCGGGCGCGGTGG - Intergenic
1123812192 15:23938855-23938877 TGTAATTTGGCCGGGCACGGTGG + Intergenic
1123908284 15:24942063-24942085 GCCATCTAGGCCGGGCACGGTGG - Intronic
1123985983 15:25646562-25646584 TCTAATTGGGCCAGGCACGGTGG + Intergenic
1124162282 15:27283314-27283336 TCTATCTTGGCCGGGCACGGTGG + Intronic
1124359799 15:29027888-29027910 TAAGACTAGGCCGGGCACGGTGG - Intronic
1124447662 15:29752389-29752411 TGAAAGTAGGCCAGGCACGATGG - Intronic
1124822137 15:33056887-33056909 TGAAACTAGGCCGGGCACAGTGG + Intronic
1124927857 15:34089141-34089163 TCTAAGTAGGCCAGGCGCGGTGG - Intronic
1125358994 15:38846310-38846332 TGTAAATAGGCTGGGCACGATGG - Intergenic
1125406879 15:39361964-39361986 TTTAACCAGGCCGGGCATGATGG + Intergenic
1125552848 15:40560293-40560315 TTTGCCTAGGCCGGGCACGGTGG - Intronic
1125645692 15:41270824-41270846 GCTAACTAGGCTGGGCATGGTGG + Intronic
1125700271 15:41676439-41676461 TCAAACCAGGCCAGGCACGGTGG - Intronic
1126282788 15:46976006-46976028 TCTCACCAGGCCAGGCACGGTGG + Intergenic
1126596147 15:50386087-50386109 TCGATCTAGGCCAGGCACGGTGG + Intergenic
1126726912 15:51640949-51640971 ACAAACTAGGCCAGGCACGGTGG + Intergenic
1127096841 15:55520366-55520388 TCAAAGCAGGCCGGGCACGATGG + Intergenic
1127230484 15:56987400-56987422 ACTAATTAGGCCAGGCACGGTGG - Intronic
1127988574 15:64094513-64094535 TGTATCTTGGCCGGGCGCGATGG + Intronic
1128016644 15:64354016-64354038 TACAAGTAGGCCGGGCACGGTGG + Intronic
1128044429 15:64605116-64605138 CCAAATTAGGCCGGGCACGGTGG - Intronic
1128294613 15:66507146-66507168 TTTAAATGGGCCGGGCACGATGG - Intronic
1128829271 15:70751946-70751968 TCTAACATGGCCGGGCACAGTGG + Intronic
1128837509 15:70822256-70822278 AGTAAATAGGCCGGGCACGGTGG - Intergenic
1128885520 15:71283254-71283276 TCTGACCTGGCCGGGCGCGATGG - Intronic
1128951128 15:71883089-71883111 TTTTATTAGGCCAGGCACGATGG - Intronic
1129339926 15:74879025-74879047 CCTAACCCGGCCGGGCACGGTGG - Intergenic
1129427736 15:75476600-75476622 TTTAACCAGGCCGGGCACGGTGG - Intronic
1129527185 15:76226589-76226611 AATAAATAGGCCGGGCACGGTGG + Intronic
1129639928 15:77365448-77365470 TCAAAACAGGCCGGGCACGGCGG + Intronic
1129767876 15:78181778-78181800 GGAAACTAGGCCGGGCACGGTGG - Intronic
1129981065 15:79871817-79871839 TTTACATAGGCCGGGCACGGTGG + Intronic
1130012986 15:80166419-80166441 TATAAGAAGGCCGGGCACGGTGG - Intronic
1130534978 15:84777983-84778005 AGTATCTAGGCCGGGCACGGTGG - Intronic
1131080427 15:89529989-89530011 GTTAACTAGGCCGGGCACAGTGG - Intergenic
1131085716 15:89574302-89574324 TATAGATAGGCCGGGCACGGTGG - Intergenic
1131267788 15:90928036-90928058 TCTCTGGAGGCCGGGCACGATGG + Intergenic
1131376947 15:91932728-91932750 TGCAAATAGGCCGGGCACGGTGG - Intronic
1131487710 15:92835786-92835808 TATAAATAGGCCGGGCACGGTGG + Intergenic
1131539692 15:93265923-93265945 TCTTTCTAGGCCAGGCACGGTGG + Intergenic
1131844570 15:96475478-96475500 CCTATGTAGGCCGGGCACGGTGG + Intergenic
1131974564 15:97931280-97931302 TCTGGCTAGGCCGGGCACGGTGG - Intergenic
1132504383 16:299940-299962 TAAAAATAGGCCGGGCACGGTGG - Intronic
1132540657 16:507396-507418 AAAAACTAGGCCGGGCACGGTGG - Intronic
1132777371 16:1602652-1602674 TCTGTCTAGGCCGGGCACGGCGG + Intronic
1133141446 16:3747673-3747695 TATAAATTGGCCGGGCACGGTGG + Intronic
1133157770 16:3887814-3887836 TAAAAATAGGCTGGGCACGATGG - Intergenic
1133252323 16:4491360-4491382 TTTTGCTAGGCCGGGCACTATGG + Intronic
1133415050 16:5600000-5600022 ACAAATTAGGCCGGGCACGGTGG + Intergenic
1134572302 16:15301653-15301675 TCTCTCTTGGCCGGGCACGGTGG + Intergenic
1134654190 16:15934707-15934729 TCTAACCAGGCCAGGCATGTTGG - Intergenic
1134730078 16:16454395-16454417 TCTCTCTTGGCCGGGCACGGTGG - Intergenic
1134876414 16:17703439-17703461 TGAGACTAGGCCGGGCACGGTGG + Intergenic
1134937354 16:18257505-18257527 TCTCTCTTGGCCGGGCACGGTGG + Intergenic
1135003377 16:18797090-18797112 TATAAATAGGCCGGGCACGGTGG + Intronic
1135059912 16:19262668-19262690 TCTAACTATGCTGGACACCAAGG - Intronic
1135124267 16:19794911-19794933 TAAAACGAGGCCGGGCACAATGG + Intronic
1135222507 16:20625006-20625028 TGTTATTAGGCCGGGCACGGTGG - Intronic
1135248779 16:20882086-20882108 TAAGACTAGGCCGGGCACGGTGG - Intronic
1135272060 16:21077986-21078008 TAGAACTAGGCCAGGCACGGTGG + Intronic
1135304789 16:21358871-21358893 ACTATATAGGCCGGGCACGGTGG + Intergenic
1135328876 16:21545080-21545102 TCTAACTCGGCCAGGCGCGGTGG + Intergenic
1135348919 16:21712551-21712573 AATCACTAGGCCAGGCACGATGG + Intronic
1135414975 16:22262222-22262244 CCCAACTAGGCCAGGCACGGTGG + Intronic
1135752031 16:25065853-25065875 GCTACTTAGGCCGGGCACGGTGG - Intergenic
1136127825 16:28197627-28197649 TCAGACTAGGCCGGGCGCGGTGG + Intronic
1136248404 16:28988421-28988443 ACCAAATAGGCCGGGCACGGTGG + Intronic
1136339223 16:29631054-29631076 TCTAACTCGGCCAGGCGCGGTGG + Intergenic
1136346663 16:29680241-29680263 TCTTAGTTGGCCGGGCACGGTGG - Intronic
1136559004 16:31027472-31027494 TAAAAATAGGCCGGGCACGGTGG - Intergenic
1136563889 16:31058101-31058123 TTAAAACAGGCCGGGCACGATGG - Intergenic
1136706268 16:32190438-32190460 TTTAAATAGGCCGGGCACGGTGG + Intergenic
1136761642 16:32738973-32738995 TTTAAATAGGCCGGGCACGGTGG - Intergenic
1136806458 16:33131417-33131439 TTTAAATAGGCCGGGCACGGTGG + Intergenic
1136986548 16:35111652-35111674 TCTAACTAGGTCAGGCACGGTGG + Intergenic
1137620262 16:49871700-49871722 GCTAACTAGGGCGGGCGCGGTGG + Intergenic
1137998532 16:53248037-53248059 TCTAATCAGGCCGGGCGCGGTGG + Intronic
1138040613 16:53661006-53661028 AATATCCAGGCCGGGCACGATGG + Intronic
1138342386 16:56298623-56298645 GTTAATTAGGCTGGGCACGATGG + Intronic
1138466702 16:57198096-57198118 ACTAAATGGGCCGGGCACGGTGG + Intronic
1138903289 16:61300303-61300325 TCTTACTAGGCCGGGCGCGGTGG - Intergenic
1139281281 16:65773017-65773039 TGAAACAAGGCCGGGCACGGTGG - Intergenic
1139396617 16:66644994-66645016 TCAAAATTGGCCGGGCACGGTGG + Intronic
1139685260 16:68598439-68598461 GCTTACCAGGCCGGGCACGGTGG + Intergenic
1139792101 16:69446609-69446631 GTTAACTAGGCCAGGCACGGTGG - Intronic
1139808733 16:69593600-69593622 TGTAACTAGGCCGGGCATGGTGG - Intronic
1139809203 16:69598735-69598757 TCAGCGTAGGCCGGGCACGATGG + Intronic
1139852257 16:69958454-69958476 CCTTCCTAGGCCGGGCACGGTGG + Intronic
1139881228 16:70181358-70181380 CCTTCCTAGGCCGGGCACGGTGG + Intronic
1139900021 16:70320842-70320864 AAAAATTAGGCCGGGCACGATGG - Intronic
1139986006 16:70899056-70899078 TTGAACTAGGCCGGGCATGGTGG - Intronic
1140087568 16:71810320-71810342 TCTAAGTAGGCCGGGCACAGTGG + Intergenic
1140097288 16:71885141-71885163 TCCAACCAGGCCGGGCACAGTGG - Intronic
1140107217 16:71971927-71971949 AGTAATTAGGCCGGGCACGGTGG + Intronic
1140431213 16:74905392-74905414 AATAAATAGGCCGGGCACGGTGG + Intronic
1140700862 16:77580386-77580408 TGTATTTAGGCCGGGCACGGTGG + Intergenic
1140993581 16:80238092-80238114 TATAACTTGGCCGGGCGCGGTGG - Intergenic
1141465394 16:84202461-84202483 CCTAAGTCGGCCGGGCACGGTGG - Intergenic
1141713638 16:85714703-85714725 TCTTCCAAGGCCGGGCACGGTGG - Intronic
1141814357 16:86399703-86399725 TCTAAATAGGCCGGGCACGGTGG + Intergenic
1141815103 16:86404524-86404546 ACTAAATAGGCCGGGCACGGTGG - Intergenic
1203063799 16_KI270728v1_random:999286-999308 TTTAAATAGGCCGGGCACGGTGG - Intergenic
1142477235 17:196062-196084 TCTAAATAGGCTGGGCATGGTGG + Intergenic
1142604080 17:1072188-1072210 TCTAGGGAGGCCGGGCACGGTGG - Intronic
1142628981 17:1211791-1211813 TGTAACAAGGCCGGCCACGGTGG + Intronic
1142681152 17:1549603-1549625 TCTTTCTAGGCCAGGCACGGTGG - Intronic
1142718092 17:1758375-1758397 TGGAACTGGGCCGGGCACGGTGG + Intergenic
1142726168 17:1815985-1816007 TTTAAATAGGCCGGGCATGGTGG - Intronic
1142734836 17:1890373-1890395 AATAAATAGGCCGGGCACGGTGG + Intronic
1142918563 17:3163941-3163963 ACTAACCCGGCCGGGCACGGTGG + Intergenic
1143077752 17:4359581-4359603 TCTGATTAGACCGGGCGCGATGG + Intronic
1143232251 17:5366800-5366822 TCAAATTTGGCCGGGCACGGTGG + Intronic
1143297375 17:5881448-5881470 CCAAACCAGGCCGGGCACGGTGG - Intronic
1143806217 17:9429412-9429434 TGTAAATAGGCCAGGCACGGTGG + Intronic
1143877722 17:10004722-10004744 TCTTCCTAGGCTGGGCACGGTGG + Intronic
1143928884 17:10399914-10399936 TCTTAATAGGCCGGGCGCGGTGG + Intronic
1144069377 17:11654066-11654088 TCGATCTAGGCCGGGCGCGGTGG + Intronic
1144124542 17:12190190-12190212 TGCAGCTAGGCCGGGCACGGTGG + Intergenic
1144467411 17:15507549-15507571 TCTAAATAGGCCGGGCGCGGTGG + Intronic
1144488859 17:15690529-15690551 AGTAACTAGGCCGGGCGCGGTGG + Intergenic
1144492609 17:15727423-15727445 GCTTATTAGGCCGGGCACGGTGG - Intergenic
1144653417 17:17020839-17020861 TAAAACTAGACCGGGCACGGTGG - Intergenic
1144673212 17:17144568-17144590 GCAAGCTAGGCCGGGCACGGTGG + Intronic
1144683305 17:17209684-17209706 AAAAACTAGGCCGGGCACGGTGG - Intronic
1144907643 17:18649235-18649257 GCTTATTAGGCCGGGCACGGTGG + Intronic
1145410356 17:22655428-22655450 TCTAAATAGGCCAGGCATGGTGG + Intergenic
1145806893 17:27740787-27740809 TCTGACTGGGACGGGCACGAAGG - Intergenic
1145872310 17:28285056-28285078 TGTAACTAGGCTGGGCGCGGTGG - Intergenic
1146049875 17:29541395-29541417 CCTATCTAGGCCGGGCGCGGTGG - Intronic
1146079933 17:29770394-29770416 TCTAATTAGGCTGGGCAAGGTGG - Intronic
1146118003 17:30159947-30159969 CATACCTTGGCCGGGCACGATGG - Intronic
1146235362 17:31155013-31155035 ACTAAATAGGCTGGGCACGGTGG - Intronic
1146290700 17:31604923-31604945 TCTATATAAGCCAGGCACGAGGG + Intergenic
1146722772 17:35134762-35134784 TGTAACTAGGCTGGGCATGGCGG + Intronic
1146963866 17:37008574-37008596 TGTAACTAGGCTGGGCATGGTGG + Intronic
1147245225 17:39115825-39115847 TGTAACTAGGCCAGGCATGGTGG + Intronic
1147299777 17:39516948-39516970 TCTACATTGGCCGGGCACGGTGG - Intronic
1147549092 17:41425894-41425916 TTAAACTAGGCCGGGCGCGGTGG + Intergenic
1147621161 17:41868149-41868171 TAAAAATAGGCCGGGCACGGTGG + Intronic
1147666646 17:42153126-42153148 AATAAGTAGGCCGGGCACGGTGG + Intronic
1147777828 17:42915655-42915677 TATAACAAGGCCGGGCACGGTGG + Intergenic
1147874144 17:43608867-43608889 GCTAAATAGGCCGGGCACAGTGG + Intergenic
1148008393 17:44453818-44453840 TGTAACTAGGCTGGGCACGATGG - Intronic
1148137516 17:45303867-45303889 CCAAACTAGGCCAGGCACGGTGG - Intronic
1148423577 17:47570132-47570154 TTTACCTAGGCCGGGCATGGTGG + Intronic
1148869370 17:50647162-50647184 TCACACTTGGCCGGGCACAATGG - Intronic
1148941292 17:51214252-51214274 TCTACTTAGGCTGGGCACAATGG - Intronic
1149004315 17:51789301-51789323 TGTAATTGGGCCGGGCACGGTGG - Intronic
1149009361 17:51839203-51839225 ACTACCTTGGCCGGGCACGGTGG + Intronic
1149158406 17:53661894-53661916 TCTAAATTGGCCGGGAACGGTGG + Intergenic
1149316206 17:55441151-55441173 GCAATCAAGGCCGGGCACGATGG - Intergenic
1149580806 17:57749191-57749213 TCTATCTAAGCCAGGCACGGTGG + Intergenic
1149724020 17:58873882-58873904 TAACACTAGGCCGGGCACGGTGG - Intronic
1149816291 17:59727419-59727441 TCTAACAGGGCCAGGCATGATGG - Intronic
1149939197 17:60844940-60844962 TCCAACAAGGCTGGGCACGGTGG + Intronic
1149978605 17:61291065-61291087 GCAAACTAGGCCGGGCGCGGTGG - Intronic
1150027269 17:61689721-61689743 AGTCACTAGGCCGGGCATGAAGG + Intronic
1150063552 17:62089698-62089720 ACAAATTAGGCCGGGCACGGTGG + Intergenic
1150095833 17:62374171-62374193 TATAGCTAGGCCGGGCACGGTGG + Intronic
1150173221 17:63022051-63022073 ACAAACTAGGCCGGGCGCGGTGG + Intronic
1150333208 17:64311069-64311091 TGCAACTTGGCCGGGCACGGTGG - Intergenic
1150522619 17:65885001-65885023 ACAAACTAGGCCGGGCGCGATGG - Intronic
1150646449 17:66980904-66980926 TCTAACAAGGCCGGGTGCGGTGG - Intronic
1150732743 17:67710158-67710180 TTAAGCAAGGCCGGGCACGATGG + Intergenic
1150745229 17:67811334-67811356 AATAAATAGGCCGGGCACGGTGG - Intergenic
1150750974 17:67862261-67862283 AGTAACTAGGCCGGGCACGATGG - Intronic
1150800154 17:68275065-68275087 ACTAACTAGGCTGGGCGCGGTGG - Intronic
1151204688 17:72497610-72497632 TCAAGCTAGGCCGGGCACGGTGG + Intergenic
1151250907 17:72834332-72834354 TCTTACTAGGCTGGGCACGGTGG + Intronic
1151402945 17:73868063-73868085 ACAAACGAGGCCGGGCACGATGG - Intergenic
1151448828 17:74184770-74184792 TATATCTAGGCCGGGCAAGGTGG - Intergenic
1151471059 17:74318048-74318070 TTTTAATAGGCCGAGCACGACGG - Intergenic
1151598553 17:75092610-75092632 ACACACTTGGCCGGGCACGATGG - Intronic
1151614561 17:75200837-75200859 TCTAAATAGGCCAGGCAAGGTGG + Intergenic
1151648720 17:75452132-75452154 TCTGCCTAGGCCGGGCGCGGTGG - Intronic
1151793671 17:76327365-76327387 TAAAAATAGGCCGGGCACGGTGG + Intronic
1151864377 17:76790668-76790690 TCTAACTCGGCCGGGCGTGGTGG + Intergenic
1152055744 17:78024650-78024672 TCTAAATAGGCCAGGCGCGGTGG - Intronic
1152076546 17:78163577-78163599 TAAAACCAGGCCGGGCACGGTGG + Intronic
1152102049 17:78307668-78307690 CCTAATTAGGCCGGGCATGGTGG - Intergenic
1152201513 17:78949645-78949667 TCTCAATTGGCCGGGCGCGATGG + Intergenic
1152457133 17:80422984-80423006 TCTCCCTAGGCCGGGCGCGGTGG - Intronic
1152621951 17:81369351-81369373 TCAGACTAAGCCGGGCACGGTGG - Intergenic
1152833833 17:82516446-82516468 TCTAATATGGCCGGGCACGGTGG + Intergenic
1152844999 17:82594209-82594231 TCTAGACAGGCCGGGCACGGCGG + Intronic
1153207474 18:2718838-2718860 TCAAAATGGGCCGGGCACGGTGG - Intronic
1153295695 18:3544100-3544122 TGAAAGTAGGCCGGGCACGGTGG + Intronic
1153340745 18:3972222-3972244 TATCACTAGGCCGGGCATGGTGG + Intronic
1153353206 18:4105741-4105763 TGTAATTAGGCCGGGCGCGGTGG + Intronic
1153394483 18:4603239-4603261 TTTAAATAGGCCGGGCAGGATGG + Intergenic
1153414083 18:4825976-4825998 TGCAACTAGGCCGGGCACAGTGG + Intergenic
1153808459 18:8731284-8731306 TTAAAATAGGCTGGGCACGATGG + Intronic
1153848092 18:9067834-9067856 TATAACTAGGCCGGGTAAGGTGG - Intergenic
1153916767 18:9752510-9752532 CCGAGCTGGGCCGGGCACGATGG - Intronic
1153955426 18:10091822-10091844 TGCAACTAGGCTGGGCACGGTGG - Intergenic
1154248425 18:12720876-12720898 TATTGCTAGGCCGGGCACGGTGG + Intronic
1154964036 18:21338899-21338921 TCTTATTAGGCCGGGCACAGTGG + Intronic
1156021289 18:32602174-32602196 TGAAACTAGGCTGGGCACGGTGG - Intergenic
1156437067 18:37143240-37143262 TCTAAGTAGGCCGGGCATGGTGG - Intronic
1156992734 18:43429657-43429679 ACTAAGTAGGCCGGGCAAGGTGG + Intergenic
1157200728 18:45657182-45657204 TTTGACTAGGCCGGGCACAGTGG + Intronic
1158476323 18:57783098-57783120 ACAAACTAGGCCGGGCACCGTGG - Intronic
1158683480 18:59590955-59590977 GCTAAGTAGGCCGGGCGCGGTGG + Intronic
1158794665 18:60829714-60829736 TCAAATTAGGCCGGGCGCGGTGG - Intergenic
1159053831 18:63445932-63445954 TGTGTCTAGGCCGGGCACCATGG - Intergenic
1159069413 18:63606415-63606437 CCAAAGAAGGCCGGGCACGATGG - Intergenic
1159302710 18:66596793-66596815 TCATACTAGGCCGGGCGCGGTGG + Intronic
1159522913 18:69548804-69548826 TCTACCTTGGCCGGGCGCGGTGG + Intronic
1159534128 18:69693769-69693791 TCTATTTAGGCCGGGCGCGGTGG + Intronic
1159685606 18:71415350-71415372 TTAACCTAGGCCAGGCACGATGG - Intergenic
1159738900 18:72140301-72140323 TCTAAATTGGCCGGGTACGGTGG + Intergenic
1160723270 19:606386-606408 TCCAACCAGGCCGGGCGCGGTGG - Intronic
1161035993 19:2084874-2084896 AAAAACTAGGCCGGGCACGGTGG - Intronic
1161154383 19:2724744-2724766 TTTTTCTCGGCCGGGCACGATGG + Intronic
1161212024 19:3071768-3071790 TAAAATTAGGCCAGGCACGATGG - Intergenic
1161243844 19:3238064-3238086 TCTAACTTGGCCGGGCGCCATGG + Intronic
1161259304 19:3327817-3327839 TGTATCTAGGCCGGGCGCGGTGG - Intergenic
1161318106 19:3627754-3627776 TTTATCTTGGCCGGGCACGGTGG + Intergenic
1161402158 19:4071346-4071368 TCTATTTCGGCCGGGCGCGATGG - Intergenic
1161416028 19:4146928-4146950 TCTACGTGGGCCGGGCACGGTGG - Intergenic
1161471693 19:4460309-4460331 TCTCAGTATGCCGGGCACGGTGG + Intergenic
1161473155 19:4471300-4471322 TATAACTCGGCCGGACGCGATGG - Intergenic
1161642376 19:5432348-5432370 TCTAGCGAGGCCGGGCACGGTGG + Intergenic
1161654938 19:5508358-5508380 TATTACTTGGCCGGGCACGGTGG - Intergenic
1161710842 19:5847080-5847102 TCTTTGTAGGCCGGGCACGGTGG + Intronic
1161838873 19:6666606-6666628 TAAAACTAGGCCGGGCCCGGTGG + Intronic
1161862729 19:6810414-6810436 TCTAACTTGGCCGGGCACAGTGG + Intronic
1162035479 19:7936161-7936183 CCAAACTAGGCTGGGCACGGTGG + Intronic
1162040878 19:7970440-7970462 TAAAAATAGGCCGGGCACGGTGG - Intronic
1162074588 19:8176967-8176989 ACTATCTAGGCCGGGCACAGTGG + Intronic
1162137194 19:8562819-8562841 TTTAACTTGGCCAGGCACCATGG - Intronic
1162210604 19:9088596-9088618 TCTGACTCGGCCAGGCACGGTGG + Intergenic
1162260714 19:9531695-9531717 ATTAACTTGGCCGGGCACGGTGG + Intronic
1162269537 19:9603034-9603056 ACTAAGTAGGCCGGGCACAGTGG + Intergenic
1162289324 19:9767112-9767134 TAAAACTAGGCCGGGCACAGTGG - Intronic
1162315838 19:9937337-9937359 TCTCCCTAGGCCGGGCGCGGTGG + Intergenic
1162364529 19:10240290-10240312 AAAAACTAGGCCGGGCACGGTGG - Intergenic
1162669191 19:12240154-12240176 TCTTTTTAGGCCGGGCACAATGG + Intronic
1162720490 19:12659142-12659164 TGTGTCTAGGCCGGGCACGGTGG - Intronic
1162849417 19:13419155-13419177 CATATCTAGGCCGGGCACGGTGG - Intronic
1162852994 19:13445985-13446007 ACTCATTAGGCCGGGCACGGTGG + Intronic
1162897478 19:13773936-13773958 TTTATTTAGGCCGGGCACGGTGG - Intronic
1163263497 19:16205118-16205140 GCCACCTAGGCCGGGCACGGTGG - Intronic
1163552204 19:17971749-17971771 TCTGCCTGGGCCGGGCACGGTGG - Intronic
1163590073 19:18188198-18188220 TCTACCTGGGCCGGGCACGGTGG + Intergenic
1163651033 19:18517931-18517953 AAAAACTAGGCCAGGCACGAAGG + Intronic
1163651074 19:18518210-18518232 AAAAACTAGGCCAGGCACGATGG + Intronic
1163658829 19:18564332-18564354 TCTGATTGGGCCAGGCACGATGG + Intronic
1163662185 19:18585110-18585132 TCAAGGTAGGCCGGGCACGGTGG - Intronic
1163686038 19:18712231-18712253 TCTAACTGGGCCAGGCACAGTGG - Intronic
1163870851 19:19820406-19820428 CCTAACTAGGCTGGGCGCGGTGG + Intronic
1163922932 19:20309955-20309977 TCTAAGTTGGCCGGGCACGGTGG - Intergenic
1164095844 19:22009460-22009482 TCTAATTCGGCCAGGCACGGTGG + Intronic
1164165151 19:22666939-22666961 GGTAACAAGGCCGGGCACGGTGG + Exonic
1164180952 19:22818248-22818270 TCTAACAAGGCCCAGCACGCAGG + Intergenic
1164214927 19:23135796-23135818 TCTAAATAGACCAGGCACGGTGG - Intronic
1164245390 19:23423692-23423714 TAAAACTAGGCCGGGCACAGTGG - Intergenic
1164268483 19:23645455-23645477 ATGAACTAGGCCGGGCACGGTGG - Intronic
1164275376 19:23712716-23712738 TATAAATAGGCCGGGCATGGTGG + Intergenic
1164850086 19:31474574-31474596 TCAAACTTGGCCGGGTACAATGG - Intergenic
1164959939 19:32419446-32419468 TACAAATAGGCCGGGCACGGTGG - Intronic
1165004579 19:32794390-32794412 TCTTGCTAGGCAGGGCACGGTGG - Intronic
1165041202 19:33068979-33069001 AATAAATAGGCCGGGCACGGTGG + Intergenic
1165185571 19:34018059-34018081 TTTCACTGGGCCGGGCACGGTGG + Intergenic
1165201192 19:34146197-34146219 TATATCTAGGCCGGGCACAGTGG + Intergenic
1165203756 19:34166532-34166554 TATATCTAGGCCGGGCATGGTGG + Intergenic
1165500798 19:36187641-36187663 TCTGTCTCGGCCGGGCACCATGG - Intronic
1165507310 19:36242122-36242144 TCTATCTGGGCCAGGCACGGTGG + Intronic
1165911142 19:39228730-39228752 TAAAACTAGGCCGGGCACAGTGG + Intergenic
1166085244 19:40470284-40470306 TAAAAATAGGCCGGGCACGGTGG - Intronic
1166093742 19:40526874-40526896 ACAGAGTAGGCCGGGCACGATGG - Intronic
1166207166 19:41278346-41278368 GCAAAGTAGGCCGGGCACGGTGG - Intronic
1166479239 19:43155509-43155531 TCAAACTTGGCTGGGCATGATGG + Intronic
1166720901 19:44995265-44995287 TCTAGCTGGGCCGGGCAGGGTGG - Intergenic
1166805336 19:45483578-45483600 ACTTATTAGGCCGGGCACGATGG - Intergenic
1166961322 19:46497663-46497685 CAAAACTAGGCCGGGCACGGTGG - Intronic
1167200852 19:48064139-48064161 TCTATTTTGGCCGGGCACGGTGG + Intronic
1167218060 19:48178183-48178205 AGTAACAAGGCCGGGCACGGTGG - Intronic
1167274649 19:48529523-48529545 TGAAACTTGGCCGGGCACGGTGG + Intergenic
1167274746 19:48530193-48530215 GATAAATCGGCCGGGCACGATGG - Intergenic
1167303401 19:48693205-48693227 TGTAAATAGGCCAGGCAAGATGG + Intergenic
1167966889 19:53155223-53155245 TCTAAATTGGCCAGGCACGGTGG - Intronic
1168240246 19:55085450-55085472 ACTAGCTAGGCCGGGCGCGGTGG - Intronic
1168279280 19:55295678-55295700 TATAACCAGGCCGGGCACGGAGG + Intronic
1168366601 19:55793279-55793301 TGGAAATAGGCCGGGCACGGTGG + Intronic
1168498334 19:56872837-56872859 CATAAATAGGCCGGGCACCATGG + Intergenic
925653510 2:6118516-6118538 AAATACTAGGCCGGGCACGATGG + Intergenic
926011421 2:9411432-9411454 TATTAATAGGCCGGGCACAAGGG + Intronic
926086962 2:10026530-10026552 TCTAAGGAGGCCGGGCGCGGTGG + Intergenic
926842497 2:17097754-17097776 TCAAACTGGGCCGGGCGCGGTGG - Intergenic
926878525 2:17513522-17513544 TACAACTAGGCCAGGCACGGTGG - Intronic
927490367 2:23517255-23517277 CCTAACTAGGCTGGGCGCGGTGG + Intronic
927693353 2:25223599-25223621 TCTATCAGGGCCGGGCACGGTGG - Intergenic
927728463 2:25447794-25447816 GATAACTAGGCCGGGCATGGTGG - Intronic
927730027 2:25462988-25463010 TCTGAGTAGGCCGGGCGCGGTGG - Intronic
928140726 2:28726697-28726719 TGAAAATAGGCCGGGCGCGATGG + Intergenic
928548930 2:32353174-32353196 ACAAAATAGGCCGGGCACGGTGG - Intergenic
928574304 2:32639117-32639139 AATAACTGGGCCGGGCACGGTGG - Intronic
928627433 2:33154773-33154795 TTGAACTAGGCCGGGCGCGGTGG + Intronic
928969895 2:37017139-37017161 AGAAACTAGGCCGGGCACGGTGG + Intronic
928993977 2:37266637-37266659 AAAAACTAGGCCGGGCACGGTGG - Intronic
929154964 2:38780914-38780936 AATAACTAGGCCGGGCATGGTGG - Intronic
929161536 2:38837321-38837343 TAGGACTAGGCCGGGCACGGTGG + Intronic
929485230 2:42347150-42347172 CCTTACTAGGCCGGGCGCCATGG - Intronic
929551743 2:42897687-42897709 CCTAACTAGGCCAAGCAGGATGG - Intergenic
929702602 2:44177065-44177087 TGAAACTAGGCCGGGCACGGTGG - Intronic
930106725 2:47646109-47646131 AATAAATAGGCCGGGCACGGTGG + Intergenic
931314053 2:61110390-61110412 AAAAATTAGGCCGGGCACGATGG + Intronic
931353717 2:61515794-61515816 TCCAACCTGGCCGGGCACGGTGG + Intronic
931361858 2:61584668-61584690 TAAAAATAGGCCGGGCACGGTGG + Intergenic
931433690 2:62229946-62229968 TATAAATAGGCCGGGCACAGTGG - Intergenic
931506636 2:62935040-62935062 TCCATCTTGGCCGGGCACGGTGG + Intronic
931647877 2:64441830-64441852 TGTAGCTAGGCTGGGCACGGTGG + Intergenic
931794145 2:65693361-65693383 ACAAACTAGGTCGGGCACGGTGG - Intergenic
932328865 2:70885611-70885633 TGTATTTAGGCCGGGCACGGTGG - Intergenic
932729090 2:74205108-74205130 ACAATATAGGCCGGGCACGATGG - Intronic
933014486 2:77107529-77107551 AATAACTAGGCCGGGCATGGTGG + Intronic
933734220 2:85482270-85482292 TCTCATTTGGCCGGGCACGGTGG + Intergenic
933740417 2:85529629-85529651 TCTATGTTGGCCGGGCACGGCGG + Intergenic
933818890 2:86091824-86091846 TAGAAATAGGCCGGGCACGGTGG + Intronic
933818996 2:86092535-86092557 TCTAACTCGGCTGGGCACAGTGG + Intronic
933828334 2:86184899-86184921 TCCAAGTAGGCCAGGCGCGATGG + Intronic
933829078 2:86191942-86191964 TCTTCCTAGGCTGGGCACTATGG + Intronic
933981461 2:87554249-87554271 TCTAATGAGGCCGGGCGCGGTGG + Intergenic
934513408 2:94967219-94967241 TCTAACTAGTCAGGACACTAAGG - Intergenic
934606985 2:95702984-95703006 CCTAATTAGGCCGGGCATGGTGG - Intergenic
934721287 2:96578739-96578761 ACTCATTAGGCCGGGCACGGTGG - Intergenic
934936070 2:98466331-98466353 CATAACAAGGCCGGGCACGGTGG - Intronic
935024146 2:99260248-99260270 GCTTACTTGGCCGGGCACGGTGG - Intronic
935041153 2:99428706-99428728 TGTAACTAGGCCAGGCACAGTGG + Intronic
935289255 2:101595698-101595720 TCTACCTTGGCCGGGCACGGTGG - Intergenic
935531219 2:104234627-104234649 ACTAACCAGGCCGGGCATGGTGG + Intergenic
935753464 2:106259450-106259472 TTTGACTAGGCCGGGCATGGTGG + Intergenic
935948399 2:108306618-108306640 ACTAAATAGGCTGGGCATGATGG + Intronic
935968898 2:108511052-108511074 TATAAATAGGCCGGGCGCGATGG + Intergenic
935989597 2:108706839-108706861 TCTAACCAGGCCGGGCATGGTGG + Intergenic
936132560 2:109859253-109859275 TATAAATAGGCTGGGCGCGATGG + Intergenic
936212137 2:110512232-110512254 TATAAATAGGCTGGGCGCGATGG - Intergenic
936421277 2:112366794-112366816 TATAAATAGGCTGGGCGCGATGG - Intergenic
936431809 2:112471200-112471222 TCTGTCTAGGCCGGGCACGGTGG + Intergenic
936437313 2:112519841-112519863 GAGAATTAGGCCGGGCACGATGG + Intronic
936817023 2:116472324-116472346 TTTAATTAGGCCAGGCACGGTGG + Intergenic
937391767 2:121495033-121495055 AATAAATAGGCCGGGCACGGAGG + Intronic
937425570 2:121795902-121795924 TCTCTCTAGGCCGGGCATGATGG + Intergenic
937815860 2:126250239-126250261 ACAAACTAGGCCGGGCGCGGTGG - Intergenic
938508622 2:131914608-131914630 TCTACCTAGGCCGGGCGTGGTGG - Intergenic
938839876 2:135149942-135149964 TCTAACAGGGCCAGGCACGGTGG - Intronic
939066420 2:137488048-137488070 TCAAAATAGGCCGGGCGCGGTGG - Intronic
939131161 2:138237310-138237332 TGAAACTGGGCCGGGCACGGTGG + Intergenic
939593891 2:144101153-144101175 ACTAAATGGGCCGGGCACGGTGG - Intronic
939992073 2:148885271-148885293 TATGACTGGGCCGGGCACGGTGG - Intronic
940098414 2:150005582-150005604 TGTAATTGGGCCAGGCACGATGG + Intergenic
940595697 2:155789967-155789989 GCTAACCAGGCTGGGCACGGTGG + Intergenic
940957492 2:159744273-159744295 TCCTACTAGGCCGGGCGCGGTGG - Intronic
940967235 2:159852704-159852726 GCTGACTTGGCCGGGCACGGTGG - Intronic
941108804 2:161394257-161394279 TTTATCTAGGCCGGGCACAGTGG - Intronic
941420769 2:165280932-165280954 TCATACTAGGCCGGGCATGTTGG + Intronic
941469389 2:165865463-165865485 TCAAACTAGGCCAGGCACAATGG - Intronic
941632934 2:167904346-167904368 TTTAACAAGGCCGGGCGCGGTGG + Intergenic
942126570 2:172831554-172831576 TCTATCTGGGCCAGGCACGGTGG - Intronic
942486313 2:176443404-176443426 GGTAACTAGGCCAGGCACGGTGG + Intergenic
942759387 2:179380490-179380512 TATATTTAGGCCGGGCACGGTGG + Intergenic
943556097 2:189405515-189405537 TTTAATTAGGCCAGGCACGGTGG - Intergenic
943802704 2:192082085-192082107 TGGAAATAGGCCGGGCACGGTGG - Intronic
944790478 2:203119711-203119733 TGCAACTGGGCCGGGCACGGTGG - Intronic
944811879 2:203334945-203334967 TACAACTAGGCCAGGCACGGTGG - Intronic
945427136 2:209720349-209720371 TTGAAATAGGCCGGGCACGGTGG + Intronic
945823339 2:214691134-214691156 ACTAACTAGGCCAGGCCCGGTGG + Intergenic
946275262 2:218626964-218626986 ATTAACTAGGTCGGGCACGGTGG + Intronic
946358314 2:219203063-219203085 TTGAAGTAGGCCGGGCACGGTGG - Intronic
946370104 2:219276181-219276203 TCACACCAGGCCGGGCACGGCGG + Intronic
946841253 2:223822395-223822417 TAAAAATAGGCCAGGCACGATGG + Intronic
946912193 2:224475302-224475324 ATTAAATAGGCCGGGCACGGTGG - Intronic
946957217 2:224944048-224944070 TCTAAACCGGCCGGGCATGATGG - Intronic
947172810 2:227328081-227328103 TTTAAACAGGCCGGGCACGGTGG + Intronic
947203410 2:227637352-227637374 AATAAATAGGCCGGGCACGGTGG + Intergenic
947565999 2:231193778-231193800 TATAATTAGGCCGGGTACGGTGG + Intergenic
947598266 2:231427789-231427811 TGTGACTAGGCCGGGCATGGTGG - Intergenic
947599346 2:231436215-231436237 TTTAACATGGCCGGGCACAATGG + Intergenic
947983604 2:234429965-234429987 TATAGATAGGCCGGGCACGATGG + Intergenic
948168667 2:235882760-235882782 ATTAACCAGGCCGGGCACGGTGG - Intronic
948435119 2:237947997-237948019 TTTATGTAGGCCGGGCATGATGG - Intergenic
948536075 2:238648449-238648471 TCAAACAAGGCCAGGCACGGTGG + Intergenic
1168828113 20:827775-827797 TGTGACTGGGCCGGGCACGGTGG + Intergenic
1169365515 20:4988947-4988969 GCTAACTAGGCCGGGCGCGGTGG + Intronic
1169510767 20:6261493-6261515 TCTAAACAGGCCGGGCGCGGTGG - Intergenic
1169518673 20:6347155-6347177 TATAACTAGGCCGGGAACAGTGG + Intergenic
1169615408 20:7437948-7437970 GCCAACTAGGCCGGGCGCGGTGG - Intergenic
1169794239 20:9444475-9444497 TTTCACTAGGCCGGGCACAGTGG + Intronic
1170054989 20:12192304-12192326 TCTGTCTAGGCCGGGCACGGTGG + Intergenic
1170181747 20:13538753-13538775 TCTAGCTAGGCCGGGCTGGGTGG + Intronic
1170972859 20:21132566-21132588 TCCAACTAGGCTGGGCACAGTGG - Intronic
1170986384 20:21263361-21263383 TATAAATAGGCTGGGCACGATGG + Intergenic
1171363443 20:24607070-24607092 TCCACCTTGGCCGGGCACCATGG + Intronic
1171973032 20:31576370-31576392 TCAAAAAAGGCCGGGCACCATGG + Intronic
1172254211 20:33502688-33502710 AGAAACTAGGCCGGGCACGGTGG - Intronic
1172388913 20:34552899-34552921 TCTGAGGAGGCCGGGCACAATGG + Intronic
1172408851 20:34708046-34708068 TATAGCTAGGCCGGGCACAGTGG - Intronic
1172463679 20:35138869-35138891 TCTAAGTAGGCCGGGTGCGGTGG - Intronic
1172594347 20:36140015-36140037 ACCACCTAGGCCGGGCACGGTGG - Intronic
1172696026 20:36823517-36823539 ACAAACTAGGCTGGGTACGATGG + Intronic
1173571191 20:44077370-44077392 TCAAACCAGGCCGGGCATGGTGG + Intergenic
1173587058 20:44190681-44190703 AATAAATAGGCCGGGCACGGTGG + Intergenic
1173587596 20:44194908-44194930 TAAAACTGGGCCGGGCACGGTGG - Intergenic
1173994692 20:47328743-47328765 ACTAACTTGGCCAGGCACGGTGG - Intronic
1174002801 20:47387031-47387053 TCTAAATAGGCCAGGCACGGTGG + Intergenic
1174129733 20:48334792-48334814 TCCAAATAGGCCAGGCACGGTGG + Intergenic
1174250101 20:49212883-49212905 TTCCAGTAGGCCGGGCACGATGG - Intergenic
1174328794 20:49801382-49801404 TCTGAATAGGCTGGGCACGGTGG + Intergenic
1174811452 20:53649071-53649093 TCAAAATAGGCCGGGCAACATGG + Intergenic
1174827541 20:53782184-53782206 ACAAACTAGGCCAGGCACGGTGG + Intergenic
1175139568 20:56850145-56850167 TCTGGCTTGGCCGGGCACGGTGG + Intergenic
1175207629 20:57323495-57323517 TAAACCTAGGCCGGGCACGGTGG + Intergenic
1175457924 20:59129049-59129071 TCAAAATAGGCCAGGCACGGTGG - Intergenic
1176225262 20:63994443-63994465 TCAATTTAGGCCGGGCACGGTGG - Intronic
1176275681 20:64266542-64266564 TAAAATTAGGCCGGGCACGGTGG - Intronic
1176477189 21:7232155-7232177 TCAATCAAGGCCGGGCACGGTGG + Intergenic
1176722379 21:10402884-10402906 AAAAACTAGGCCGGGCACCATGG - Intergenic
1176727816 21:10456618-10456640 CCCAAGGAGGCCGGGCACGATGG - Intergenic
1177080018 21:16627572-16627594 TCTTGCTAGGCCGGGCACAGTGG - Intergenic
1177502848 21:21981192-21981214 TCAAACTATGCTGGGCACGGTGG - Intergenic
1177545427 21:22551585-22551607 TCTTTTTAGGCCGGGCACGGTGG - Intergenic
1177889859 21:26792032-26792054 ACTAAATAGGCTGGGCACGGTGG - Intergenic
1178285152 21:31319489-31319511 TATAACCTGGCCGGGCACGGTGG + Intronic
1178748861 21:35281377-35281399 AATAAATAGGCCGGGCATGATGG - Intronic
1178785580 21:35650191-35650213 AATAAATAGGCTGGGCACGATGG + Intronic
1178938247 21:36882746-36882768 TCAGACTGGGCCGGGCACGGTGG - Intronic
1179045831 21:37844342-37844364 GCAAAGTAGGCCGGGCACGGTGG - Intronic
1179345115 21:40548915-40548937 TAAAACAAGGCCGGGCACGGTGG + Intronic
1179346111 21:40559169-40559191 TTAAAGTAGGCCGGGCACGGTGG + Intronic
1179456093 21:41501319-41501341 TCCAGCTGGGCCGGGCACGGCGG + Intronic
1179493588 21:41757231-41757253 GGCAACTAGGCCGGGCACGGTGG + Intronic
1179673843 21:42968406-42968428 TTGCAGTAGGCCGGGCACGATGG - Intergenic
1179944341 21:44661002-44661024 TATAAATAGGCCGGGCGCGGTGG + Intronic
1179970178 21:44832316-44832338 TATTTCTAGGCCGGGCACGGTGG - Intergenic
1180244961 21:46540724-46540746 CCTAACTTGGCTGGGCACGGTGG + Intronic
1180281593 22:10701076-10701098 TGTATATAGGCCGGGCACGGTGG + Intergenic
1180286580 22:10750430-10750452 CCCAAGGAGGCCGGGCACGATGG + Intergenic
1180712751 22:17850697-17850719 ACTAACTCGGCCAGGCACGGTGG - Intronic
1181092159 22:20481282-20481304 TAAAAATAGGCCGGGCACGGTGG + Intronic
1181232610 22:21430586-21430608 TGTAAATAGGCCGGGCATGGTGG + Intronic
1181246041 22:21504271-21504293 TGTAAATAGGCCGGGCATGGTGG - Intergenic
1181696948 22:24598148-24598170 TATAAATAGGCCGGGCACGGTGG + Intronic
1181801561 22:25350931-25350953 TCTTTCTAGGCCGGGTACGGTGG + Intergenic
1182221046 22:28759036-28759058 TCCAACAAGGCCGGGCGCGGTGG + Intergenic
1182243802 22:28938995-28939017 TCAAAATAGGCCAGGCACGGTGG + Intronic
1182253622 22:29021773-29021795 TAAAACAAGGCCGGGCACGGTGG - Intronic
1182263961 22:29097892-29097914 TCTAATAAGGCTGGGCACGGTGG + Intronic
1182567127 22:31208533-31208555 GCAAAATATGCCGGGCACGATGG + Intergenic
1182636247 22:31729502-31729524 TGTAACTAGGCCGGGCGTGGTGG - Intronic
1182665456 22:31955727-31955749 TCTGAACAGGCCGGGCGCGATGG - Intronic
1182728569 22:32468975-32468997 GCTAACTAGGCCGGGCGCGGTGG + Intergenic
1183132612 22:35853921-35853943 TATGACTAGGCCAGGCACGGTGG + Intronic
1183402116 22:37610678-37610700 CCTCACTAGGCCGGGCGCGGTGG - Intronic
1183851193 22:40589739-40589761 TATTACAAGGCCGGGCACGGTGG + Intronic
1183895448 22:40965015-40965037 TCTAAATAGGCCGGACGCGGTGG + Intronic
1183903691 22:41024037-41024059 AATAAATAGGCCGGGCACGGTGG - Intergenic
1183919807 22:41156431-41156453 TGTTACTTGGCCGGGCACGGTGG + Intronic
1184003231 22:41690450-41690472 GCTAACCAGGCCTGGCACCAGGG + Intronic
1184013751 22:41769845-41769867 TTCAACAAGGCCGGGCACGGTGG + Intronic
1184223679 22:43116742-43116764 TTTCACCAGGCCGGGCACGGTGG - Intronic
1184428735 22:44428599-44428621 TCTATCCAGGCCGGGCACAGTGG + Intergenic
1184724207 22:46333986-46334008 TCTTCCTAGGCCGGGCACTGTGG + Intronic
1184745972 22:46456370-46456392 CCAAAATAGGCCGGGCACGGTGG + Intronic
1185309271 22:50144866-50144888 CCAAACCAGGCCGGGCACGGTGG - Intronic
1185369296 22:50453498-50453520 GATAACTAGGCCAGGCACGGTGG + Intronic
1203238835 22_KI270732v1_random:33213-33235 TGTATATAGGCCGGGCACGGTGG + Intergenic
949259311 3:2086546-2086568 TCCAACCAGGCCAGGCACGGTGG + Intergenic
950209605 3:11112349-11112371 TGTTACTTGGCCGGGCACGGTGG - Intergenic
950577903 3:13844032-13844054 TCCAACAAGGCCAGGCACGGTGG - Intronic
950735119 3:15001099-15001121 CCTAAATAGGCTGGGCACGGTGG - Intronic
951053044 3:18116239-18116261 TTTAAATAGGCCGGGCGCGGTGG + Intronic
951066484 3:18272808-18272830 GATAACTAGGCCGGGCACGGTGG + Intronic
951131272 3:19048368-19048390 TTAAACTAGGCCGGGCACAATGG + Intergenic
951131367 3:19049430-19049452 TTAAACTAGGCCGGGCACAAAGG + Intergenic
951382395 3:22000016-22000038 TTTATCTAGGCCGGGCATGGTGG + Intronic
951890571 3:27564337-27564359 TTTATCTAGGCCAGGCACCATGG - Intergenic
951894158 3:27595187-27595209 AATAACTAGGCCGGGCACGGTGG - Intergenic
952351857 3:32546955-32546977 GCTAACTAGGCCAGGCGCGGTGG + Intronic
952400068 3:32955253-32955275 TTTAAATAGGCTGGGCACGGTGG + Exonic
952595321 3:35010479-35010501 TTTAAATAGGCCGGGCGCGGTGG - Intergenic
952768468 3:36976184-36976206 TTTGACTGGGCCGGGCACGGTGG - Intergenic
952779098 3:37076577-37076599 TAAAACTAGGCCAGGCACGGTGG + Intronic
953024273 3:39135766-39135788 CCTACCTAGGCCGGGCATGGTGG + Intronic
953444792 3:42953980-42954002 TATAACAAGGCTGGACACGATGG - Intronic
953467053 3:43131308-43131330 ACTCACTTGGCCGGGCATGATGG + Intergenic
953474434 3:43193869-43193891 TCTAAGGAGGCCAGGCACGGTGG - Intergenic
953532374 3:43750071-43750093 GCTATCTGGGCCGGGCACGGTGG + Intergenic
954015220 3:47683331-47683353 ACTGAATAGGCCGGGCGCGATGG - Intronic
954022316 3:47753056-47753078 TAAATCTAGGCCGGGCACTACGG + Intronic
954071913 3:48149247-48149269 TCCAACTGGGCCAGGCACGGTGG - Intergenic
954086793 3:48251036-48251058 TTGATCTAGGCCGGGCACGGTGG - Intronic
954087926 3:48260694-48260716 TTGATCTAGGCCGGGCACGGTGG - Intronic
954143555 3:48622683-48622705 TTTAACTAGGCTGGGCACCATGG + Intergenic
954169268 3:48787471-48787493 TATAACTTGGACGGGCACGGTGG - Intronic
954339547 3:49941853-49941875 TATAACAGGGCCGGGCACGGTGG - Intronic
954467332 3:50663787-50663809 TTTTAATGGGCCGGGCACGATGG - Intergenic
954554936 3:51510168-51510190 ACATAGTAGGCCGGGCACGATGG + Intergenic
955171661 3:56571663-56571685 TTTAAATAGGCTGGGCACGGTGG - Intronic
955305626 3:57828244-57828266 TTAAACTAGGCTGGGCATGATGG - Intronic
955628887 3:60950808-60950830 CCTACCTAGGCCGGGCATGGTGG - Intronic
955685964 3:61548978-61549000 TCATCCTAGGCCGGGCACGGTGG - Intergenic
955980846 3:64525874-64525896 TATAACTTGGCTGGGCACGGTGG - Intronic
956408058 3:68949284-68949306 ACTAATAAGGCCGGGCGCGATGG - Intergenic
957761646 3:84566482-84566504 ACTAAAAAGGCCGGGCATGATGG + Intergenic
958427006 3:93990293-93990315 TCAAACTGGGCCAGGCACGGTGG - Intronic
958566758 3:95821848-95821870 TCAGACTAGGCCGGGCACAGTGG + Intergenic
958795584 3:98703274-98703296 TCTAACGAGGCCGGGCGCGGTGG - Intergenic
958820997 3:98973546-98973568 TCAACCTAGGCCGGGCGCGGTGG - Intergenic
959113156 3:102145714-102145736 TCTATCTAGGCCGGGCGCAGTGG - Intronic
959189455 3:103091805-103091827 TAAAACTAGGCCGGGCGCGGTGG - Intergenic
959565799 3:107831961-107831983 TCTAACAAGGCCGGGCGCAGTGG + Intergenic
959656144 3:108807456-108807478 TAAAACAAGGCCGGGCACGGTGG + Intergenic
959702289 3:109309786-109309808 GGTAACAAGGCCGGGCACGGTGG + Intronic
959717657 3:109450837-109450859 TGGAACTAGGCTGGGCACGGTGG + Intergenic
960088044 3:113611606-113611628 ACCAACTAGGCCGGGCACGGTGG - Intronic
960208336 3:114930471-114930493 TGTAACTAGGCCGGGGGCGGTGG - Intronic
960462394 3:117952300-117952322 TCTAGCCAGGCCAGGCACCATGG - Intergenic
960589676 3:119353515-119353537 TATAGCTAGGCTGGGCACGGTGG + Intronic
960644651 3:119865754-119865776 TGGAAATAGGCCGGGCACGGTGG - Intronic
960649524 3:119931326-119931348 ACTAAATAGGCCGGGCACAGTGG + Intronic
961153577 3:124660218-124660240 TATAATTAGGCCGGGCACAGTGG - Intronic
961175338 3:124830694-124830716 TCTTCCTTGGCCGGGCACGGTGG + Intronic
961255144 3:125543417-125543439 TCTTACTAGGCTGGGCGCGGTGG - Intronic
961693913 3:128690801-128690823 TCTGTCTAGGCTGGGCACGGTGG - Intergenic
962547598 3:136453302-136453324 GCTAAGTTGGCCGGGCACGGTGG + Intronic
962792279 3:138822244-138822266 TATAACTAGGCCGGGTATGGTGG + Intronic
963110556 3:141684341-141684363 ACTAATTTGGCCGGGCACGGTGG + Intergenic
964031837 3:152147329-152147351 TTTAAATAGGCCGGGCACTGTGG - Intergenic
964109888 3:153077207-153077229 TGCAACTGGGCCGGGCACGGTGG + Intergenic
964220706 3:154341005-154341027 TAAATCTTGGCCGGGCACGATGG - Intronic
964365961 3:155951022-155951044 TAAAACTAGGCCGGGCGCGGTGG - Intergenic
964424740 3:156540316-156540338 TCAATCTAGGCCGGGCGCGGTGG + Exonic
965410277 3:168321349-168321371 TCAACCTGGGCCGGGCACGGTGG - Intergenic
965414892 3:168380774-168380796 TCAAAATTGGCCGGGCACGGTGG - Intergenic
965589712 3:170350916-170350938 CCTAACTAGGCCGAGCACAGTGG - Intergenic
965621067 3:170642664-170642686 TTTAACTAGGCTGGGCACGGTGG - Intronic
965735897 3:171820152-171820174 TTTAAGGAGGCCGGGCACGGTGG - Intergenic
965964390 3:174469048-174469070 TATAGTTAGGCCGGGCACGGTGG - Intronic
965995043 3:174871609-174871631 ACTAACTTGGCCGGGCACAGTGG + Intronic
966056800 3:175703453-175703475 TCTAAGTTGGCCGGGCATGGTGG + Intronic
966522626 3:180890236-180890258 TCTAAGTAGGCCGGGCGCGGTGG + Intronic
966739013 3:183214697-183214719 AAAAACTTGGCCGGGCACGATGG + Intronic
967178377 3:186881898-186881920 TACATCTAGGCCGGGCACGATGG - Intergenic
967199419 3:187058926-187058948 TAAAAGTAGGCCAGGCACGATGG - Intronic
967335352 3:188337785-188337807 AATAACTGGGCCAGGCACGATGG - Intronic
967898973 3:194427509-194427531 TAAAACTAGGCCAGGCACGGTGG + Intronic
968147813 3:196314216-196314238 TGGAAATAGGCCGGGCACGGTGG + Intronic
968174303 3:196536060-196536082 ACTATCTAGGCCGGGCACAGTGG - Intergenic
968202670 3:196768952-196768974 TAAAAGTAGGCCGGGCACGGTGG - Intronic
968240639 3:197080747-197080769 TGTTACTAGGCCGGGCATGGTGG - Intronic
968454768 4:691721-691743 TCTAAATGGGCTGGGCACGGTGG + Intergenic
968720882 4:2203292-2203314 TCAAACTGGGCCGGGCGCGGTGG + Intronic
969395744 4:6919904-6919926 AATAAATAGGCCGGGCACGGTGG - Intronic
970579913 4:17465710-17465732 TTTAACCAGGCCGGGCACAGTGG + Intronic
970982336 4:22114516-22114538 TGAAACTAGGCCAGGCACGGTGG + Intergenic
971275101 4:25188706-25188728 TATAAATAGGCCGGGCACAGTGG - Intronic
971282720 4:25254697-25254719 TTTCACTGGGCCGGGCACGGTGG - Intronic
971926874 4:33022598-33022620 TCTACCTAGGCCAGGCACAGTGG - Intergenic
971932956 4:33108709-33108731 TGTAACTGGGCCGGGCATGGTGG - Intergenic
971997124 4:33978981-33979003 CCTAACCAGGCCAGGCACGGTGG - Intergenic
972132626 4:35857487-35857509 TCTCACTCGGCCGGGCACGGTGG + Intergenic
972215643 4:36894605-36894627 TCTCTCTCGGCCGGGCACGGTGG + Intergenic
972459082 4:39282683-39282705 GCAAAATAGGCCGGGCACGGTGG - Intronic
972611552 4:40660322-40660344 TATAACTAGGCCGGGCTCGGTGG + Intergenic
972691196 4:41399967-41399989 TCCACCTCGGCCGGGCACGGTGG - Intronic
973133914 4:46682537-46682559 TCTAATTAGGCCGGGCGCAGTGG + Intergenic
973206424 4:47565245-47565267 GCTAACCAGGCCGGGCGCGGTGG - Intronic
973231856 4:47848600-47848622 TCTGATTAGGCCGGGCACGGTGG + Intronic
973301824 4:48593649-48593671 AATAAATAGGCCGGGCACGGTGG - Intronic
973990193 4:56398079-56398101 TATAACTTGGCCGGGCACGATGG + Intronic
974462461 4:62205613-62205635 TCTCTCTGGGCCGGGCACGGTGG + Intergenic
974568531 4:63611449-63611471 ACTAACTAGGCAGGGCATGGTGG + Intergenic
975330686 4:73109009-73109031 TTTATCTAGGCTGGGCATGATGG + Intronic
975356071 4:73405873-73405895 TTTAAATAGGCCGGGCGCGGTGG - Intronic
975636323 4:76453003-76453025 TATATCTAGGCTGGGCACGGTGG - Intronic
976192824 4:82504741-82504763 TCTAACTGGGCCAAGCACGGTGG + Intronic
976253541 4:83077603-83077625 TTGAAATAGGCCGGGCACGGTGG + Intergenic
976415594 4:84770313-84770335 TATAACTCGGCCGGGCGCGGTGG - Intronic
976602823 4:86953996-86954018 CTGAACTAGGCCGGGCACGGTGG - Intronic
977000248 4:91489515-91489537 GCTTCCTAGGCCGGGCACGGTGG + Intronic
977232426 4:94467597-94467619 TCTCATTAGGCCAGGCACGGTGG - Intronic
977260020 4:94786829-94786851 GCTAAGTGGGCTGGGCACGATGG - Intronic
977519512 4:98063161-98063183 TCAATCTAGGCTGGGCACGGTGG + Intronic
977533580 4:98229806-98229828 CAAAACTAGGCCGGGCACGGTGG + Intergenic
977571475 4:98633790-98633812 TCAATCACGGCCGGGCACGATGG + Intronic
977691386 4:99915422-99915444 TCTAACTTGGCCAGGCACAGTGG - Intronic
977872840 4:102113553-102113575 TGTTACCTGGCCGGGCACGATGG - Intergenic
978052755 4:104222788-104222810 ACCAACCAGGCCGGGCACGGTGG - Intergenic
978455344 4:108883309-108883331 TATTTCTAGGCCGGGCACGGTGG - Intronic
978582364 4:110244884-110244906 TCAAACTGGGCCAGGCACGGTGG - Intergenic
978797124 4:112719439-112719461 TATAATTCGGCCGGGCACGGTGG + Intergenic
979229358 4:118329077-118329099 TTTAAATAGGCTGGGCACGGTGG - Intronic
979470549 4:121091389-121091411 CCAAAGTAGGCCGGGCACGGTGG + Intergenic
979509975 4:121541402-121541424 TAAAAATAGGCCGGGCACGGTGG + Intergenic
979574096 4:122265979-122266001 CCTATCTAGGCCGGGCACGGTGG - Intronic
980666365 4:135941597-135941619 TTTAATTGGGCCGGGCGCGATGG - Intergenic
980928402 4:139161681-139161703 TCTGAGTAGGCCGGGCGCGGTGG + Intronic
981004298 4:139859492-139859514 TAGAACTTGGCTGGGCACGATGG - Intronic
981027005 4:140086870-140086892 TGAAAATAGGCCGGGCACGGTGG + Intronic
982104712 4:152001337-152001359 TATAACTAGGTTGGGCACGGTGG - Intergenic
982458553 4:155639284-155639306 TAAAAGTAGGCCGGGCACGGTGG + Intergenic
982705896 4:158709238-158709260 TTTTACTTGGCCGGGCACGGTGG + Exonic
982737323 4:159019923-159019945 CCTAAATGGGCCGGGCACGGTGG + Intronic
982850509 4:160309524-160309546 TATATCTCGGCCGGGCACGGTGG + Intergenic
982964975 4:161894750-161894772 TTTGACTGGGCCGGGCATGACGG - Intronic
983120700 4:163881185-163881207 TCCAACAAGGCCGGGCATGGTGG + Intronic
983226942 4:165094322-165094344 CCAAACTAGGCCGGGCATGGTGG - Intronic
983321928 4:166205741-166205763 TCCATCTAGGCCTGGCACGGTGG - Intergenic
983400806 4:167263322-167263344 TCTATCATGGCCGGGCACGGTGG + Intergenic
983406667 4:167339605-167339627 ACTGATTAGGCCGGGCACGGTGG + Intergenic
983422436 4:167536268-167536290 TATAACTTGGCCGGGCACGGTGG - Intergenic
984185419 4:176537533-176537555 TCTAAATAGGCTGGGCACAGTGG - Intergenic
984216696 4:176922096-176922118 TATACCTTGGCCGGGCACGGTGG - Intergenic
984240000 4:177206795-177206817 TGGAACTAGGCCGGGCACAGTGG + Intergenic
984260971 4:177443309-177443331 ATGAACTAGGCTGGGCACGATGG + Intergenic
984532201 4:180930745-180930767 ACTCTCTAGGCCGGGCGCGATGG + Intergenic
984591481 4:181622386-181622408 TATAACTAGGCCAGGCACAGTGG + Intergenic
984766765 4:183405923-183405945 TTTATGTAGGCCAGGCACGATGG + Intergenic
984798452 4:183689026-183689048 TCAAACTGGGCCAGGCATGATGG - Intronic
985079348 4:186247958-186247980 TGTATCCAGGCCGGGCACGGTGG + Intronic
985095218 4:186406596-186406618 GCTTATTTGGCCGGGCACGATGG + Intergenic
985215768 4:187652004-187652026 TCAATATAGGCCGGGCACGGCGG + Intergenic
985280107 4:188277860-188277882 TATTTCTAGGCTGGGCACGATGG - Intergenic
985283730 4:188312854-188312876 AGTAACTAGGCCGGGCACTGTGG - Intergenic
985412763 4:189703479-189703501 TAAAACTAGGCCGGGCGCGGTGG + Intergenic
985654886 5:1125635-1125657 TCTACCTGGGCCGGGCACAGTGG + Intergenic
985673845 5:1220120-1220142 TCAGACAAGGCCGGGCACGGTGG + Intronic
985768210 5:1792687-1792709 TTTAACTAGGCCAGGCACAGTGG - Intergenic
986047301 5:4051739-4051761 TCTCACTGGGCCGGGCACGGTGG + Intergenic
986160996 5:5229009-5229031 TCTAAGTTGGCCGGGCGCGGTGG + Intronic
986412821 5:7498533-7498555 TTTTACTTGGCCGGGCACGGTGG - Intronic
986495280 5:8335345-8335367 CATAAGTAGGCCGGGCACGGTGG + Intergenic
986883559 5:12205676-12205698 TGAAACTAGGCCGGGCGCGGTGG - Intergenic
986971924 5:13347046-13347068 GCTAATTAGGCCGGGCGCGGTGG + Intergenic
987044770 5:14097611-14097633 AATAACTAGGCCAGGCACGGTGG + Intergenic
987131121 5:14861063-14861085 TATATGTAGGCCGGGCACGGTGG - Intronic
988158136 5:27481212-27481234 TTAAACTTGGCCGGGCACGGTGG - Intergenic
988477592 5:31600954-31600976 TCCCACAAGGCCAGGCACGATGG - Intergenic
988534039 5:32050216-32050238 CCTGACAAGGCCGGGCACGGTGG - Intronic
988787014 5:34574400-34574422 TTTAACTTGGCCAGGCACGGTGG + Intergenic
989036329 5:37176346-37176368 TGTAAAGAGGCTGGGCACGATGG + Intronic
989042960 5:37248415-37248437 TCTAATTTGGCCGGGCACAGTGG - Intronic
989241683 5:39209614-39209636 TCTAAATAGGCCGGGTGCGGTGG - Intronic
989450622 5:41582685-41582707 TGTAACCTGGCCAGGCACGATGG + Intergenic
989589865 5:43103396-43103418 TGAATCTAGGCCGGGCACGGTGG + Intronic
989634489 5:43519901-43519923 TTTAAGTAGGCTGGGCACGGTGG + Intergenic
989726177 5:44589235-44589257 GGAAACTAGGCCGGGCACGGTGG + Intergenic
990242771 5:53832489-53832511 TTTAAATAGGCCGGGCACGGTGG - Intergenic
991175622 5:63684366-63684388 GGTAACTAGGCTGGGCACGGTGG - Intergenic
991490772 5:67180709-67180731 TGAATCTTGGCCGGGCACGATGG + Intergenic
991664971 5:68990513-68990535 TCTGAGTAGGCCGGGCACGGTGG - Intergenic
992055701 5:72987161-72987183 TTAAAATAGGCCGGGCACGGTGG - Intronic
992234522 5:74695551-74695573 TCTAGCAAGGCTGGGCACGGTGG + Intronic
992554547 5:77890508-77890530 TTTAACTTGGCCAGGCACGGTGG - Intergenic
992776228 5:80091528-80091550 AATAACTAGGCCGGGCGCGGTGG - Intergenic
993033002 5:82726553-82726575 GCTAACTCGGCCGGGCGCGGTGG + Intergenic
993303191 5:86240072-86240094 TCAAAATAGGCCGGGCACAGGGG - Intergenic
993669567 5:90743756-90743778 TCAAATGAGGCCGGGCACGGTGG - Intronic
993720758 5:91319435-91319457 TAAAAATAGGCCGGGCACGGTGG - Intergenic
994166824 5:96617500-96617522 TCTTAGGAGGCCGGGCACGGTGG + Intronic
994182440 5:96782294-96782316 TGTAACTAGGCCAGGCGCGGTGG - Intronic
994641417 5:102414604-102414626 ACAAGCCAGGCCGGGCACGATGG + Intronic
994645453 5:102463597-102463619 ACAAAATAGGCCGGGCACGGTGG + Intronic
995174383 5:109158087-109158109 TTTAAATAGGCTGGGCACGGTGG + Intronic
995561120 5:113382539-113382561 ACTAATTAGGCTGGGCACCATGG - Intronic
995709149 5:115017221-115017243 TCCAATTAGGCCGGGCATGGTGG + Intergenic
995996691 5:118308788-118308810 TCTAACATGGCCAGGCACGGTGG - Intergenic
997049682 5:130364887-130364909 TAAAAATAGGCCGGGCACGGTGG + Intergenic
997459739 5:134043818-134043840 TCTACCTAGGCTGGGCGCGGTGG - Intergenic
997563152 5:134866235-134866257 ACTAATTAGGCCGGGCACGGTGG - Intergenic
997917541 5:137943457-137943479 TCTAAATGGGCCAGGCACGGTGG + Intronic
997928118 5:138049558-138049580 TCACTCTAGGCCGGGCACGGTGG - Intronic
997948236 5:138221231-138221253 CCTAACTAGGCCTGGCGCGGTGG - Intergenic
997987980 5:138519374-138519396 TCTCTCTCGGCCGGGCACGATGG + Intronic
998248332 5:140530500-140530522 TGTATCTAGGCTGGGCACGGTGG - Intronic
998272002 5:140714925-140714947 AGAAACTAGGCCGGGCACGATGG - Intergenic
998508300 5:142690032-142690054 TTTACCTTGGCCGGGCACGGTGG + Intronic
999010159 5:148028998-148029020 TAAAACTGGGCCGGGCACGATGG + Intronic
999299874 5:150484830-150484852 TCCAACTGGGCCGGGCGCGGTGG - Intergenic
1000202935 5:159029665-159029687 AATAACTAGGCCGGGCACCATGG + Intronic
1000233951 5:159340427-159340449 GCTATTTAGGCCGGGCACGGTGG - Intergenic
1000321432 5:160137724-160137746 GTCAACTAGGCCGGGCACGGTGG + Intergenic
1001408288 5:171492323-171492345 CCATTCTAGGCCGGGCACGATGG - Intergenic
1002127697 5:177059020-177059042 CCTAAATAGGCCGGGCACAATGG - Intronic
1002172331 5:177382385-177382407 CCAAACTAGGCCGGGCGCGGTGG - Intronic
1002479099 5:179487622-179487644 TCTGACTCGGCCGGGCGCGGTGG + Intergenic
1002490602 5:179573807-179573829 ACAAAGTAGGCCGGGCACGGTGG - Intronic
1002867434 6:1134399-1134421 TGAAAGTAGGCCGGGCACGGTGG - Intergenic
1003309074 6:4953094-4953116 GCTAAATAGGCCGGGCACAGTGG + Intronic
1003546303 6:7061986-7062008 TTTAATAAGGCCGGGCATGAAGG + Intergenic
1003821131 6:9898359-9898381 ACAAACAAGGCCGGGCACGGTGG - Intronic
1004130971 6:12919426-12919448 TCTTTATAGGCCGGGCACGGTGG - Intronic
1004502275 6:16219616-16219638 TATAATAAGGCCGGGCACGGTGG + Intergenic
1004624461 6:17361817-17361839 TCAAAATTGGCCGGGCACGGTGG - Intergenic
1004849030 6:19677115-19677137 TTGAAATAGGCCGGGCACGGTGG + Intergenic
1005271990 6:24176003-24176025 CCTAATTAGGCCGGGCATGGTGG + Intronic
1005573733 6:27172589-27172611 TATATACAGGCCGGGCACGATGG + Intergenic
1005629433 6:27693781-27693803 ACTAACTCGGCCGGGCGCGGTGG - Intergenic
1006037366 6:31224148-31224170 CCTAACTAGGCTGGGCGCGGTGG - Intergenic
1006149352 6:31978073-31978095 TCTAAGTAGGCCGGGCGAGATGG - Intronic
1006224678 6:32527211-32527233 TCAATATAGGCCGGGCACGGTGG + Intronic
1006280166 6:33046006-33046028 TCTAGGAAGGCCGGGCACGGTGG - Intergenic
1006589500 6:35143766-35143788 TCTAACTCGGCTGGGCTCGGTGG + Intronic
1006597006 6:35200967-35200989 CCTCCCTAGGCCGGGCACGGTGG + Intergenic
1006691089 6:35886365-35886387 ACTGAGTAGGCCGGGCACGGTGG - Intronic
1006761972 6:36470860-36470882 TCTTCCTAGGCCCGGCACGGTGG + Intronic
1006946818 6:37790108-37790130 GCTAACAAGGCCGGGCATGGTGG - Intergenic
1007031263 6:38629534-38629556 AGTAAATAGGCCGGGCACGGTGG + Intronic
1007106548 6:39287117-39287139 GATAACAAGGCCGGGCACGGTGG - Intergenic
1007151597 6:39697833-39697855 TCAGTCTAGGCCGGGCACGGTGG - Intronic
1007678103 6:43614978-43615000 TGTAACTCGGCCGGGTACAATGG + Exonic
1007912647 6:45531465-45531487 TCAAAATAGGCCAGGCACGGTGG + Intronic
1008180083 6:48317728-48317750 TAGAACTAGGCCAGGCACGGTGG + Intergenic
1008825808 6:55692260-55692282 TCTATTTCGGCCGGGCACGGTGG + Intergenic
1009639519 6:66314850-66314872 TCTGAGGAGGCCGGGCACGGTGG - Intergenic
1010191674 6:73202559-73202581 GCTAATTCGGCCGGGCACGGTGG + Intergenic
1010447711 6:75966888-75966910 ACAAACAAGGCCGGGCATGATGG + Intronic
1011268917 6:85555700-85555722 CCTAACGAGGCCAGGCACGGTGG + Intronic
1011692109 6:89879672-89879694 TCTTTCTAGGCTGGGCGCGATGG + Intergenic
1012709992 6:102586612-102586634 TCTCAATAGGCTGGGCACAAGGG - Intergenic
1013029951 6:106323524-106323546 TATAACTTGGCCGGGCGTGATGG - Intronic
1013284224 6:108666628-108666650 TGAATCTAGGCCGGGCACGGTGG - Intronic
1013491561 6:110651443-110651465 AAAAAATAGGCCGGGCACGATGG + Intronic
1014098914 6:117488354-117488376 AATAACTAGGCCGGGCAGGGCGG + Intronic
1014123562 6:117752403-117752425 TGGAACTAGGCCGGGCGCGGTGG + Intergenic
1014292069 6:119570402-119570424 TATAATTTGGCAGGGCACGATGG - Intergenic
1014447499 6:121545846-121545868 TTAGACCAGGCCGGGCACGATGG - Intergenic
1014577366 6:123090106-123090128 AAAAACTAGGCCGGGCACGGTGG - Intergenic
1015076363 6:129163344-129163366 TCTCATTAGGCCGGGCACAGTGG + Intronic
1015780042 6:136855625-136855647 CTTAAATAGGCCGGGCACGGTGG - Intronic
1015893541 6:137994243-137994265 TCAACCTTGGCCGGGCACGGTGG + Intergenic
1016003248 6:139063677-139063699 TCTTTCCAGGCCGAGCACGATGG - Intergenic
1016033082 6:139357731-139357753 TCAAACTGGGCCGGGCACGGTGG - Intergenic
1016173343 6:141047431-141047453 TCTCAGCAGGCCGGGCACGGTGG + Intergenic
1016277487 6:142371770-142371792 AGTAACTGGGCCGGGCACGGTGG - Intronic
1016710887 6:147170755-147170777 TCTCATTAGGCCGGGCACCATGG + Intergenic
1016815354 6:148298298-148298320 TATAATAAGGCCGGGCACGGCGG - Intronic
1017014314 6:150087940-150087962 TATAACCAGGCCAGGCACGGTGG + Intergenic
1017029341 6:150207148-150207170 TCAAAATAGGCCGGGCACAGTGG - Intronic
1017117761 6:150995226-150995248 GCTTACCAGGCCGGGCACGGTGG + Intronic
1017162399 6:151377819-151377841 TTTAACTTGCCCGGGCACGGTGG - Intronic
1017287405 6:152691710-152691732 TCAAACTTGGCTGGGCACAATGG - Intergenic
1017453165 6:154573597-154573619 GCTAATGAGGCCGGGCACGATGG - Intergenic
1017804878 6:157936237-157936259 TCTAAATAGGCCAGGCACAGTGG + Intronic
1017822506 6:158059840-158059862 ACTCACTAGGCCGGGCGCGGTGG - Intronic
1017827249 6:158091028-158091050 TAAAACTAGGCCGGGCGCGGTGG + Intronic
1018100391 6:160433393-160433415 TCAAATTAGGCTGGGCATGATGG + Intronic
1018422284 6:163649927-163649949 TACAACTAGGCCGGGCATGGTGG - Intergenic
1019169378 6:170123448-170123470 TCCATCTCGGCCGGGCACGGTGG + Intergenic
1019373820 7:677981-678003 TCTACACAGGCCGGGCACGGTGG + Intronic
1019380693 7:721357-721379 TCTTTCTGGGCCGGGCACGGTGG + Intronic
1019886967 7:3913578-3913600 TGTAACAGGGCCGGGCACGGTGG - Intronic
1019940294 7:4284014-4284036 TACAACTCGGCCGGGCACGGTGG + Intergenic
1020062477 7:5162718-5162740 TGGAACTAGGCCGGGCACAGTGG + Intergenic
1020165674 7:5805981-5806003 TGGAACTAGGCCGGGCACAGTGG - Intergenic
1020384287 7:7581032-7581054 TAAAAATAGGCCGGGCACGGTGG + Intronic
1020401562 7:7784630-7784652 TTTAAGTAGGCCGGGCACGGTGG - Intronic
1020777903 7:12478466-12478488 ACCAAATAGGCTGGGCACGATGG - Intergenic
1020936905 7:14477035-14477057 TTTTAGTAGGCCGGGCACGGTGG - Intronic
1021100393 7:16582321-16582343 TCAAACTAGGCAGGAGACGAAGG + Intergenic
1021101474 7:16589324-16589346 TATGACCAGGCCGGGCATGATGG + Intergenic
1021152547 7:17169029-17169051 TATAACTAAGCCGGGCGCGGTGG + Intergenic
1021582589 7:22172409-22172431 TTAAAATAGGCCGGGCACGGTGG - Intronic
1021669232 7:23018299-23018321 TTGAACTAGGCCGGGCATGGTGG - Intergenic
1021789025 7:24181401-24181423 TGAAACTAGGCCGGGCACGGTGG + Intergenic
1021976195 7:26013136-26013158 TGTCATTAGGCCGGGCACGGTGG - Intergenic
1022073331 7:26939745-26939767 TCTTAATTGGCCGGGCACGATGG - Intronic
1022168453 7:27797282-27797304 TCAAAATAGGCCGGGCGCGGTGG - Intronic
1022180745 7:27916949-27916971 ACTGACTAGGCCTGGCACAATGG + Intronic
1022741393 7:33124741-33124763 TCTGACCAGGCCGGGCACGGTGG - Intergenic
1023014002 7:35948325-35948347 TCAACCTAGGCCGGGCACAGTGG - Intergenic
1023327283 7:39074059-39074081 TCTAAATTGGCCGGGCATGGTGG + Intronic
1023375682 7:39552757-39552779 TACAACTAGGCCGGGCGCGGTGG - Intergenic
1023469853 7:40504719-40504741 TGGATCTAGGCCGGGCACGGTGG - Intronic
1024066987 7:45746664-45746686 TCAACCTAGGCCGGGCACAGTGG + Intergenic
1024861003 7:53841290-53841312 AATATCTAGGCCGGGCACGGTGG - Intergenic
1025000869 7:55313515-55313537 TCTAAGAAGGCCAGGCACGGTGG + Intergenic
1025039221 7:55625688-55625710 TTAATCTTGGCCGGGCACGACGG + Intergenic
1025171023 7:56756789-56756811 TCATACTAAGCCGGGCACGATGG + Intergenic
1025620291 7:63164170-63164192 TGTAACTAGGCCAGGCGCGGTGG + Intergenic
1025700854 7:63818904-63818926 TCATACTAAGCCGGGCATGATGG - Intergenic
1025860116 7:65318829-65318851 TCTAAGTTGGCCGGGCACAGTGG + Intergenic
1025934041 7:66019912-66019934 GTTACATAGGCCGGGCACGATGG + Intergenic
1026173035 7:67971450-67971472 CCTATCTAGGCCGGGCATGGTGG - Intergenic
1026247495 7:68634124-68634146 GCTAACTAGGCTGGGCACAGTGG - Intergenic
1026357435 7:69571129-69571151 TCTTACTGGGCCGGGCATGGTGG + Intergenic
1026544008 7:71305929-71305951 TCTAATTAGGCCGGGCATGGTGG + Intronic
1026616001 7:71905224-71905246 AATAAATAGGCCAGGCACGATGG - Intronic
1026769886 7:73189116-73189138 TCTTTCTAGGCTGGGCACGGTGG + Intergenic
1026779569 7:73255940-73255962 AGTAACTGGGCCGGGCACGGTGG + Intergenic
1026834024 7:73626290-73626312 TATAAATAGGCTGGGCACGGTGG - Intergenic
1027010754 7:74742498-74742520 TCTTTCTAGGCTGGGCACGGTGG + Intronic
1027020425 7:74809349-74809371 AGTAACTGGGCCGGGCACGGTGG + Intronic
1027027853 7:74867446-74867468 AATAAATAGGCCGGGCACGGTGG + Intergenic
1027059895 7:75076625-75076647 AATAAATAGGCCGGGCACGGTGG - Intergenic
1027067600 7:75136587-75136609 AGTAACTGGGCCGGGCACGGTGG - Intronic
1027077288 7:75203542-75203564 TCTTTCTAGGCTGGGCACGGTGG - Intergenic
1027124086 7:75543622-75543644 TTGAATCAGGCCGGGCACGATGG - Intronic
1027145225 7:75689216-75689238 TAAAAATAGGCCGGGCACGGTGG + Intronic
1027417078 7:77984922-77984944 ACAAACTAGGCCGGGCGCGGTGG - Intergenic
1027483220 7:78725509-78725531 TTAAACTAGGCCAGGCACGGTGG + Intronic
1027905827 7:84180231-84180253 GCTAAGCAGGCCGGGCACGGTGG - Intronic
1028203879 7:87994446-87994468 AGTAACTAGGCCGGGCGCGGTGG - Intronic
1028419342 7:90614290-90614312 TGGAACTAGGCCGGGGACGGTGG - Intronic
1028572758 7:92309637-92309659 TTTAAATAGGCCGGGCACGGTGG + Intronic
1028597231 7:92558394-92558416 TAAAAATAGGCCGGGCACGGTGG - Intergenic
1029049782 7:97673378-97673400 TCAGTCTAGGCCGGGCACGGTGG + Intergenic
1029260409 7:99298518-99298540 TGTTCATAGGCCGGGCACGATGG - Intergenic
1029433987 7:100551490-100551512 TGAAACAAGGCCGGGCACGGTGG - Intronic
1029703292 7:102261827-102261849 CCAAACTCGGTCGGGCACGATGG + Intronic
1029801503 7:102952694-102952716 TCCAACAAGGCCAGGCACCATGG + Intronic
1029935990 7:104424702-104424724 TCTGACTTGGCCGGGCGCGGTGG + Intronic
1030011812 7:105176920-105176942 TATGACTAGGCAGGGCATGATGG - Intronic
1030307785 7:108036473-108036495 ATTAAGTAGGCCGGGCACGGTGG - Intronic
1030821562 7:114098848-114098870 TATAACTAGGCCAGGCACAGTGG + Intronic
1031038725 7:116816539-116816561 TCTCAATAGGCTGGGCACAATGG + Intronic
1031333510 7:120496709-120496731 TTTAAGAAGGCCGGGCACGGTGG - Intronic
1031574097 7:123394750-123394772 TCTCACTTGGCCGGGCATGGTGG - Intergenic
1032161158 7:129511893-129511915 ACTAACTCGGCCTGGCAAGATGG + Intronic
1032209070 7:129895611-129895633 TCCTACTAGGCCAGGCACGGTGG + Intronic
1032376112 7:131419527-131419549 TGTAATGAGGCCAGGCACGATGG - Intronic
1032715323 7:134504477-134504499 TGTGACTAGGCCGGGCACGGTGG + Intergenic
1033112672 7:138595898-138595920 GCAAACTAGGCCGGGCACGGTGG + Intronic
1033177262 7:139136210-139136232 GCAAACTAGGCCGGGCGCGGTGG - Intronic
1033299411 7:140173874-140173896 ACTTACTAGGCCGGGCAGGGTGG + Intronic
1033391787 7:140935831-140935853 TAAAAATAGGCCGGGCACGGTGG + Intergenic
1033621377 7:143064730-143064752 TGTAACAAGGCCGGGCATGGTGG + Intergenic
1033715523 7:143997960-143997982 ACTAACAAGGCCGGGCATGGTGG + Intergenic
1033796716 7:144853953-144853975 ATTAAATAGGCCGGGCACGGTGG + Intergenic
1034325673 7:150229935-150229957 TCTAATGAGGCCGGGCATGGTGG + Intergenic
1034602281 7:152271383-152271405 CCCAAGGAGGCCGGGCACGATGG + Intronic
1034767528 7:153739323-153739345 TCTAATGAGGCCGGGCATGGTGG - Intergenic
1035149283 7:156853940-156853962 TCTATGTGGGCCAGGCACGATGG - Intronic
1035189103 7:157150088-157150110 TCTAACAAGGCCAGGCATGGTGG + Intronic
1035821585 8:2598674-2598696 TCTGCCCAGGCCGGGCACGGTGG + Intergenic
1036152394 8:6310730-6310752 TCAAACTCAGCCGGGCACGGTGG + Intergenic
1037350008 8:17942706-17942728 TTTGAATAGGCCGGGCACGGTGG + Intronic
1037559724 8:20062094-20062116 TGTATCTAGGCCGGGCATGGTGG - Intergenic
1037831660 8:22193494-22193516 TCTACCTTGGCCAGGCACGGTGG + Intronic
1038302646 8:26368817-26368839 TATATATAGGCCGGGCACGGTGG + Intronic
1038766765 8:30435957-30435979 TCTAACCAGGCCAGGCACAGTGG - Intronic
1038806794 8:30801243-30801265 TCAAACAGGGCCGGGCACGGTGG + Intronic
1039058662 8:33556399-33556421 ACCATCTAGGCCGGGCACCATGG - Intronic
1039159313 8:34599150-34599172 GCTTTCTAGGCCGGGCATGATGG + Intergenic
1039311187 8:36320137-36320159 TCTAGGAAGGCCGGGCATGATGG - Intergenic
1039500529 8:38013048-38013070 TCTGTCTAGGCAGGGCACGGTGG + Intergenic
1039508281 8:38068227-38068249 TGAAACTAGGCCAGGCACGGTGG - Intergenic
1039990992 8:42487462-42487484 TAAAAATAGGCCGGGCACGGTGG - Intronic
1040011891 8:42668269-42668291 TCTACCTAGGCAGGGCGCGGTGG - Intergenic
1040696501 8:50006246-50006268 TGCTACTAGGCCGGGCACGGTGG - Intronic
1040873814 8:52129176-52129198 TCTACATAGGCCAGGCACGGTGG + Intronic
1040881255 8:52207196-52207218 TATAACTAGGCCAGGCATGGTGG + Intronic
1041237963 8:55823831-55823853 TAAACCTAGGCCGGGCACGGTGG + Intronic
1041578564 8:59429789-59429811 TCAAACTGGGCCGGGCATGGTGG + Intergenic
1042213794 8:66408555-66408577 ACAATCCAGGCCGGGCACGATGG + Intergenic
1042237159 8:66624822-66624844 TCTTTCTAGGTCGGGCACCATGG + Intergenic
1042569870 8:70151573-70151595 TGTATTTAGGCCGGGCGCGATGG - Intronic
1042900454 8:73720797-73720819 TTAAACTAGGCCGGGCGCGGTGG - Intronic
1042909977 8:73816743-73816765 TAAAACAAGGCCGGGCACGGAGG + Intronic
1043411198 8:79997766-79997788 TACAACTAGGCCGGGCATGGTGG + Intronic
1043454637 8:80401247-80401269 TCTATCTAGGCCAGGCAAGGTGG + Intergenic
1044009290 8:86972235-86972257 TCTATTTAGGCCAGGCACGGTGG - Intronic
1044021357 8:87109823-87109845 TCTGACTTGGCTGGGCACGGTGG - Intronic
1044343278 8:91071633-91071655 TTTAACAGGGCCGGGCACGGTGG - Intronic
1044685193 8:94819877-94819899 TAAAAATAGGCCGGGCACGGTGG - Intronic
1044975072 8:97656586-97656608 GCTTAATAGGCCGGGCACGGTGG - Intronic
1045509812 8:102805976-102805998 TGTAACAAGGCTGGGCACTATGG - Intergenic
1045629486 8:104101414-104101436 TCCAAGAAGGCCGGGCACGGTGG - Intronic
1045639175 8:104228313-104228335 TGAAGCTAGGCCGGGCACGGTGG - Intronic
1045842191 8:106593489-106593511 TCTGATTTGGCCAGGCACGATGG + Intronic
1046225345 8:111271821-111271843 ACCAACCAGGCCGGGCACGGTGG + Intergenic
1046646150 8:116787748-116787770 TCTTAAGAGGCCGGGCACGGTGG - Intronic
1046746403 8:117880876-117880898 TCAAAACAGGCCGGGCACGGTGG - Intronic
1046948258 8:119995297-119995319 TAAAAGTAGGCCGGGCACGGTGG + Intronic
1046973599 8:120249203-120249225 TGAAACTAGGCCGGGCGCGGTGG - Intronic
1047208508 8:122821990-122822012 TCACACTAGGCTGGGCACGGTGG - Intronic
1047511597 8:125520172-125520194 TATACATAGGCCGGGCACGGTGG - Intergenic
1047581971 8:126225779-126225801 TGGAACAAGGCCGGGCACGGTGG + Intergenic
1048185987 8:132241174-132241196 GCTAGCTAGGCTGGGCACGGTGG - Intronic
1048309603 8:133309878-133309900 TTTAACTCGGCCGGGCGCGGTGG - Intergenic
1049366780 8:142242672-142242694 GCTAACAGGGCCGGGCACGGTGG + Intronic
1049764706 8:144349393-144349415 TCCAAATAGGCCGGGCGCGGTGG + Intergenic
1051373000 9:16374213-16374235 TAAAAATAGGCCGGGCACGGTGG + Intergenic
1051429175 9:16964545-16964567 TGCATCTAGGCCGGGCACGGTGG + Intergenic
1051470561 9:17435848-17435870 GCTACCCTGGCCGGGCACGATGG - Intronic
1051762599 9:20483996-20484018 TTTTACTGGGCCGGGCACGGTGG - Intronic
1052191277 9:25665581-25665603 GTTAACCAGGCCGAGCACGATGG - Intergenic
1052656106 9:31363401-31363423 ACAAAATAGGCCGGGCACGGTGG + Intergenic
1052868599 9:33481896-33481918 AATAAATAGGCCGGGCACGGTGG + Intergenic
1053102535 9:35382849-35382871 TCAAACTTGGCTGGGCACGGTGG - Intronic
1053257863 9:36634421-36634443 GCTAATTAGGCCAGGCACGGTGG + Intronic
1053347878 9:37391425-37391447 AATAAATAGGCCAGGCACGAGGG - Intergenic
1053826113 9:42026307-42026329 TCTTTCTCGGCCGGGCACGGTGG + Intronic
1054236359 9:62561925-62561947 TCTGTCTAGGCTGGGCACGGTGG - Intergenic
1054604450 9:67161089-67161111 TCTTTCTCGGCCGGGCACGGTGG - Intergenic
1055236535 9:74129558-74129580 ACAAACTAGGCCGGGCGCGGTGG + Intergenic
1055886664 9:81070836-81070858 TCTTAAGAGGCCGGGCACGGTGG - Intergenic
1055933804 9:81586302-81586324 CCTAACAAGGCCAGGCACGGAGG - Intronic
1055990961 9:82105156-82105178 TCTATCTAGGCCGGGCGTGGTGG - Intergenic
1056204087 9:84303605-84303627 TCTAAAGAGGCAGGGCACGGTGG - Intronic
1056529430 9:87473841-87473863 ACTTATTAGGCCGGGCACGGTGG + Intergenic
1056661361 9:88546052-88546074 CATAATTAGGCCGGGCACGGTGG - Intronic
1057010098 9:91593091-91593113 CCTAACAAGGCTGGGCACGGTGG + Intronic
1057016814 9:91659190-91659212 TATAGCTAGGCCGGGCATGGTGG + Intronic
1057047226 9:91895555-91895577 TCTATTTAGGCCAGGCACGGTGG + Intronic
1057271198 9:93652576-93652598 TCAAACTAGGCTGGGCATGGTGG - Intronic
1057358243 9:94349690-94349712 ACTATCAAGGCCGGGCACGGTGG + Intergenic
1057649506 9:96907926-96907948 ACTATCAAGGCCGGGCACGGTGG - Intronic
1058181898 9:101808870-101808892 TCAAAATAGGCCGGGCATGGTGG + Intergenic
1058691704 9:107525592-107525614 TCTTTTTAGGCCGGGCACGGTGG + Intergenic
1058841505 9:108914112-108914134 TCTACTGAGGCCGGGCACGGTGG + Intronic
1058904550 9:109471343-109471365 TGTATGTGGGCCGGGCACGATGG - Intronic
1059012229 9:110474285-110474307 TAAAACTAGGCCAGGCAAGATGG - Intronic
1059114728 9:111591002-111591024 TATATATAGGCCGGGCACGGTGG + Intronic
1059116395 9:111603626-111603648 TAAAATTAGGCCGGGCACGGTGG - Intergenic
1059133076 9:111775283-111775305 TAAAAGTAGGCCGGGCACGGTGG - Intronic
1059302463 9:113325240-113325262 CATATCTAGGCTGGGCACGATGG - Intronic
1059489720 9:114657161-114657183 TTCAACAAGGCCGGGCACGGTGG - Intergenic
1059650011 9:116307310-116307332 ACAAACCAGGCCGGGCACGGTGG + Intronic
1060083322 9:120673678-120673700 ACTCAATAGGCCGGGCACGGTGG + Intronic
1060347767 9:122831670-122831692 ATTAAATAGGCCGGGCACGATGG + Intergenic
1060386458 9:123233911-123233933 TAAAACTAGGCCGGGCGCGGTGG + Intronic
1060451478 9:123745061-123745083 TATAAGTAGGCCAGGCACGGTGG - Intronic
1060471549 9:123952319-123952341 CCTAAGTAGGCCAGGCACGGTGG - Intergenic
1060496098 9:124119579-124119601 TCCAACTCGGCCAGGCACGGTGG + Intergenic
1060576999 9:124705021-124705043 TTTAACTAGGCCAGGCACAGTGG - Intronic
1060606965 9:124923769-124923791 TCTACATAGGCCATGCACGATGG - Intronic
1060640433 9:125233627-125233649 TCCAGATAGGCCGGGCACGGTGG - Intronic
1060695970 9:125709205-125709227 TCTATATAGGCCGGGCACGGTGG + Intergenic
1060698220 9:125728402-125728424 TCTAGACAGGCCAGGCACGATGG + Intergenic
1060729579 9:126028910-126028932 GCTAACTTGGCCGGGCACAGTGG - Intergenic
1060863288 9:126974159-126974181 TCAAACTAGGCTGGGCACAGTGG - Intronic
1061162591 9:128903738-128903760 CCTACCTAGGCCGGGCACGGTGG + Intronic
1061274866 9:129564157-129564179 CCTAACTAGGCCAGGCACGGTGG + Intergenic
1062007951 9:134250901-134250923 TGTCCCTAGGCCGGGCGCGATGG + Intergenic
1062576415 9:137210851-137210873 ACAAAAAAGGCCGGGCACGACGG + Intronic
1185450663 X:279482-279504 TATTATTAGGCCGGGCACGGTGG + Intronic
1185485784 X:481211-481233 TCCAACCTGGCCGGGCACGGTGG - Intergenic
1185637986 X:1568864-1568886 TATAAATTAGCCGGGCACGATGG + Intergenic
1185654732 X:1675346-1675368 TCTATCTAGGCCGAGTACGGTGG - Intergenic
1185660300 X:1722553-1722575 AATAAATAGGCCGGGCACGGTGG + Intergenic
1185760934 X:2689987-2690009 TCAAACTAGGCCGGGCGCGGTGG - Intergenic
1186327259 X:8493279-8493301 CCTATCTTGGCCGGGCACGGTGG - Intergenic
1186828190 X:13362929-13362951 TATAAATGGGCCAGGCACGATGG - Intergenic
1186856564 X:13632152-13632174 AATAATTAGGCCGGGCACGGTGG + Intronic
1186865122 X:13712953-13712975 CCTATCTGGGCCGGGCACGGTGG + Intronic
1187079260 X:15969100-15969122 CCTTAATAGGCCGGGCGCGATGG - Intergenic
1187131102 X:16503919-16503941 TCTAACTGGGCCAGGCGCGGTGG + Intergenic
1187360407 X:18621017-18621039 GCTAACTAGGCCAGGCACAGTGG - Intronic
1187444330 X:19347180-19347202 AAAAACTAGGCCGGGCATGATGG - Intronic
1187492322 X:19763732-19763754 ACAAAGTAGGCCGGGCACGGTGG + Intronic
1187709114 X:22036345-22036367 ACTAATTAGGCCAGGCACGGTGG - Intronic
1188095957 X:26021679-26021701 TCAAATTCGGCCGGGCACGGTGG - Intergenic
1188173354 X:26956616-26956638 TATAACTAGGCCGGGCATAGTGG + Intergenic
1188375165 X:29419606-29419628 TCTGAGTAGGCCGGGCACGGTGG - Intronic
1188405919 X:29809388-29809410 TCAAACTCGGCCGGGCACGGTGG - Intronic
1188488721 X:30713019-30713041 TCCAACAAGGCCGGGCGCGGTGG - Intronic
1189437260 X:41004188-41004210 TTTCCCTAGGCTGGGCACGATGG + Intergenic
1189620440 X:42831490-42831512 TCTATCTAGGCCAGGCACGGTGG - Intergenic
1189796720 X:44652699-44652721 TTTAACCAGGCCGGGCATGGTGG + Intergenic
1189797605 X:44660439-44660461 TTTACCAGGGCCGGGCACGATGG - Intergenic
1189820144 X:44862435-44862457 TCTCACATGGCCGGGCACGGTGG + Intergenic
1189824440 X:44902673-44902695 TGTAAATAGGCCGGGCACTGTGG - Intronic
1190008419 X:46760859-46760881 TCTAGCTAGGCTGGGCACGGTGG + Intergenic
1190073598 X:47299222-47299244 AATAACTTGGCCGGGCACGGTGG + Intergenic
1190178755 X:48173525-48173547 TCTTTCTAGGCAGGGCACGGTGG - Intergenic
1190338695 X:49279394-49279416 TTCAACCAGGCCGGGCACGGTGG + Intronic
1190822931 X:53991372-53991394 TATAACAAGGCCGGGCATGTTGG + Intronic
1190822974 X:53991714-53991736 TATAACTAGGCCAGGCAAGGTGG + Intronic
1190835644 X:54098326-54098348 TCATAATAGGCCGGGCACGGTGG - Intronic
1191031712 X:55980903-55980925 TTTAAGTAGGCCGGGCCCGGTGG + Intergenic
1192339317 X:70249666-70249688 TAAAACTTGGCCGGGCACGATGG - Intergenic
1192466729 X:71362357-71362379 TAAAAATAGGCTGGGCACGATGG - Intergenic
1192737744 X:73864593-73864615 TCTCAGTAGGCCGGGCACGGTGG + Intergenic
1192800897 X:74463812-74463834 ACCAAATAGGCCGGGCACGGTGG - Intronic
1192997723 X:76530044-76530066 ACTAAATAGGACGGGCAAGATGG - Intergenic
1193619310 X:83731858-83731880 TCAAAATAGGCCGGGCGCGGTGG - Intergenic
1193653084 X:84163350-84163372 TATAACTCGGCCGGGCGCGGTGG + Intronic
1193762175 X:85480652-85480674 CCAAAATAGGCCGGGCACGGTGG + Intergenic
1193803482 X:85966060-85966082 ACTAATCAGGCCGGGCACGGTGG + Intronic
1194679991 X:96840898-96840920 TCAAAATGGGCCGGGCACGGTGG - Intronic
1195142682 X:101978840-101978862 TGAAACTAGGCCAGGCACGGTGG - Intergenic
1195235170 X:102889714-102889736 TCAAAATGGGCCGGGCACGGTGG - Intergenic
1195271972 X:103241065-103241087 TTTAACTTGGCCGGGCGCGGTGG - Intergenic
1195663765 X:107408943-107408965 TAAAAATAGGCCGGGCACAATGG - Intergenic
1195773509 X:108377641-108377663 TGTAACTCGGCCGGGCGCGGTGG + Intronic
1195804547 X:108748710-108748732 TCATAATAGGCCGGGCACGGTGG - Intergenic
1195919661 X:109971102-109971124 TCTGGATAGGCCGGGCACGGTGG + Intergenic
1196398612 X:115291084-115291106 ACTAACTAGGCCGGGGGCGGTGG - Intronic
1196415272 X:115464594-115464616 TGTAACCCGGCCGGGCACGGTGG + Intergenic
1196771875 X:119302504-119302526 TGAAACTAGGCCGGGCACAGTGG + Intergenic
1196805885 X:119585450-119585472 ACCATCTAGGCCGGGCACGGTGG - Intergenic
1196824543 X:119730929-119730951 TATATTTAGGCCGGGCACGGTGG - Intergenic
1197115609 X:122829213-122829235 AATAAATAGGCCAGGCACGATGG + Intergenic
1197221244 X:123915965-123915987 AATAATTAGGCCGGGCACGGTGG + Intergenic
1197232014 X:124015271-124015293 TCAAACTAGGCCAGGCACGGTGG - Intronic
1197313622 X:124936757-124936779 TATAACTAGGCCGGGCATGGTGG + Intronic
1197725695 X:129774966-129774988 TTCAAGTAGGCCGGGCACGGTGG - Intergenic
1198205743 X:134462603-134462625 TCTACCTAGGCCAGGCACGGTGG - Intronic
1198216026 X:134555569-134555591 TCTAACTTGGCTGGGCACAGTGG - Intergenic
1198452274 X:136778764-136778786 TCAAATAAGGCCGGGCATGATGG - Intronic
1198461370 X:136865970-136865992 GCTAATGAGGCCGGGCACGGTGG + Intronic
1198465588 X:136902014-136902036 AATAAATAGGCCGGGCACGGTGG + Intergenic
1198505720 X:137299611-137299633 TGTAAATTGGCCGGGCACGGTGG + Intergenic
1198763411 X:140057597-140057619 ACAAACTTGGCCGGGCACGGTGG + Intergenic
1199782783 X:151078204-151078226 TCAACCTAGGCCAGGCACGGTGG - Intergenic
1200113052 X:153753236-153753258 TATGAATAGGCCGGGCACGGTGG + Intergenic
1200139992 X:153895593-153895615 TAAAACTAGGCTGGGCACGGTGG + Intronic
1201280272 Y:12336374-12336396 TCTGACTAGGCCGGGCACAGTGG + Intergenic
1201375825 Y:13317871-13317893 ACAAAGTAAGCCGGGCACGATGG + Intronic