ID: 1082824402

View in Genome Browser
Species Human (GRCh38)
Location 11:57567509-57567531
Sequence CGGAGGGGATGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9447
Summary {0: 1, 1: 2, 2: 70, 3: 1058, 4: 8316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082824388_1082824402 18 Left 1082824388 11:57567468-57567490 CCTGGTGCCCAGACAAATAAATA 0: 1
1: 0
2: 0
3: 14
4: 227
Right 1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG 0: 1
1: 2
2: 70
3: 1058
4: 8316
1082824390_1082824402 10 Left 1082824390 11:57567476-57567498 CCAGACAAATAAATAAATGTGCT 0: 1
1: 0
2: 3
3: 48
4: 377
Right 1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG 0: 1
1: 2
2: 70
3: 1058
4: 8316
1082824387_1082824402 19 Left 1082824387 11:57567467-57567489 CCCTGGTGCCCAGACAAATAAAT 0: 1
1: 0
2: 5
3: 36
4: 321
Right 1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG 0: 1
1: 2
2: 70
3: 1058
4: 8316
1082824389_1082824402 11 Left 1082824389 11:57567475-57567497 CCCAGACAAATAAATAAATGTGC 0: 1
1: 0
2: 3
3: 74
4: 672
Right 1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG 0: 1
1: 2
2: 70
3: 1058
4: 8316
1082824386_1082824402 23 Left 1082824386 11:57567463-57567485 CCAGCCCTGGTGCCCAGACAAAT 0: 1
1: 0
2: 0
3: 13
4: 214
Right 1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG 0: 1
1: 2
2: 70
3: 1058
4: 8316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082824402 Original CRISPR CGGAGGGGATGGAGGGAGGA GGG Intronic
Too many off-targets to display for this crispr