ID: 1082824742

View in Genome Browser
Species Human (GRCh38)
Location 11:57569223-57569245
Sequence TGAGACTATTGATCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082824742_1082824747 20 Left 1082824742 11:57569223-57569245 CCTGCCTGTGATCAATAGTCTCA No data
Right 1082824747 11:57569266-57569288 GAGTGGCAGGCATTGCCAATAGG No data
1082824742_1082824744 3 Left 1082824742 11:57569223-57569245 CCTGCCTGTGATCAATAGTCTCA No data
Right 1082824744 11:57569249-57569271 AACAAGCGCCTACTACTGAGTGG No data
1082824742_1082824748 30 Left 1082824742 11:57569223-57569245 CCTGCCTGTGATCAATAGTCTCA No data
Right 1082824748 11:57569276-57569298 CATTGCCAATAGGAAACACCAGG No data
1082824742_1082824745 7 Left 1082824742 11:57569223-57569245 CCTGCCTGTGATCAATAGTCTCA No data
Right 1082824745 11:57569253-57569275 AGCGCCTACTACTGAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082824742 Original CRISPR TGAGACTATTGATCACAGGC AGG (reversed) Intergenic
No off target data available for this crispr