ID: 1082824744

View in Genome Browser
Species Human (GRCh38)
Location 11:57569249-57569271
Sequence AACAAGCGCCTACTACTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082824742_1082824744 3 Left 1082824742 11:57569223-57569245 CCTGCCTGTGATCAATAGTCTCA No data
Right 1082824744 11:57569249-57569271 AACAAGCGCCTACTACTGAGTGG No data
1082824743_1082824744 -1 Left 1082824743 11:57569227-57569249 CCTGTGATCAATAGTCTCAGTCA No data
Right 1082824744 11:57569249-57569271 AACAAGCGCCTACTACTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082824744 Original CRISPR AACAAGCGCCTACTACTGAG TGG Intergenic
No off target data available for this crispr