ID: 1082825133

View in Genome Browser
Species Human (GRCh38)
Location 11:57571920-57571942
Sequence GGTATTCTTGCCACAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082825132_1082825133 -6 Left 1082825132 11:57571903-57571925 CCAGGAGGGGAGCTGGGGGTATT No data
Right 1082825133 11:57571920-57571942 GGTATTCTTGCCACAAGAGCAGG No data
1082825131_1082825133 -5 Left 1082825131 11:57571902-57571924 CCCAGGAGGGGAGCTGGGGGTAT No data
Right 1082825133 11:57571920-57571942 GGTATTCTTGCCACAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082825133 Original CRISPR GGTATTCTTGCCACAAGAGC AGG Intergenic
No off target data available for this crispr