ID: 1082834449

View in Genome Browser
Species Human (GRCh38)
Location 11:57641241-57641263
Sequence AACATTGCACTGCTAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082834449_1082834454 14 Left 1082834449 11:57641241-57641263 CCTGTCACTAGCAGTGCAATGTT No data
Right 1082834454 11:57641278-57641300 CGTGTAGTGCTACCCAGCGCTGG No data
1082834449_1082834452 -10 Left 1082834449 11:57641241-57641263 CCTGTCACTAGCAGTGCAATGTT No data
Right 1082834452 11:57641254-57641276 GTGCAATGTTAAAAGGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082834449 Original CRISPR AACATTGCACTGCTAGTGAC AGG (reversed) Intergenic
No off target data available for this crispr