ID: 1082835153

View in Genome Browser
Species Human (GRCh38)
Location 11:57646077-57646099
Sequence AAGGAGAAAGCAGTGATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 1, 2: 12, 3: 81, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082835147_1082835153 22 Left 1082835147 11:57646032-57646054 CCCTTCCTTGTACTTCTGGCTCG 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG 0: 1
1: 1
2: 12
3: 81
4: 468
1082835149_1082835153 17 Left 1082835149 11:57646037-57646059 CCTTGTACTTCTGGCTCGTCTCA 0: 1
1: 0
2: 0
3: 17
4: 783
Right 1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG 0: 1
1: 1
2: 12
3: 81
4: 468
1082835148_1082835153 21 Left 1082835148 11:57646033-57646055 CCTTCCTTGTACTTCTGGCTCGT 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG 0: 1
1: 1
2: 12
3: 81
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082835153 Original CRISPR AAGGAGAAAGCAGTGATTGT AGG Intronic
901053503 1:6437736-6437758 GAGGAGAAATCAGTGAGTGGAGG + Intronic
902239669 1:15080240-15080262 AAGTATAAAGCAGTTATTGTTGG + Intronic
902480777 1:16710429-16710451 GAGGAGAAATCAGTGAGTGGGGG - Intergenic
903212017 1:21823876-21823898 AATGAGGAAGCTGTGTTTGTGGG - Exonic
904777915 1:32922961-32922983 CAGGAGAAAGCAGCGGTTGGAGG + Intergenic
905276371 1:36821318-36821340 ATGGAGAAAGCAGAGATTAGAGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906401209 1:45506108-45506130 AAGGATAAAGAAGTGCTGGTTGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907832421 1:58077721-58077743 AAGGAGAAAGGAAAGATTGACGG + Intronic
908443146 1:64175164-64175186 AAATAGATAGCAGTGATTATTGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
908554891 1:65248082-65248104 CTGGAGCGAGCAGTGATTGTGGG + Intergenic
909185836 1:72484527-72484549 AATGAGAAAGCAGACACTGTAGG + Intergenic
909541713 1:76799100-76799122 ATGGAGAAAGTAGTGACAGTTGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909774897 1:79471555-79471577 TTGGAGAAAGCACAGATTGTTGG + Intergenic
909901229 1:81138291-81138313 AAGCTGAAAGCATTGATTTTAGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911123103 1:94315400-94315422 AAGGAGAAAGTCGTACTTGTAGG + Intergenic
911603367 1:99871453-99871475 AATGAGAAAGTAGGGTTTGTAGG + Intronic
911986997 1:104639498-104639520 AACTAGAATGCAGTAATTGTTGG + Intergenic
912182352 1:107234734-107234756 ATGGAGAAAGCATTGATAGTCGG + Intronic
912260307 1:108105019-108105041 AAGGTGCAAGCAGTGTTTATTGG - Intergenic
912332183 1:108830111-108830133 AAGGAGAGAGTAGGGATGGTGGG + Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917036296 1:170750651-170750673 AGGCAGAAAGCAGGCATTGTAGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918683788 1:187389522-187389544 AAGGAGAATGCAGTGGCTTTGGG + Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919541013 1:198845488-198845510 CAGGAGAAAGCAGTGCTGGCTGG + Intergenic
920040621 1:203093278-203093300 AAGAAGACAGCAGGGATTGTTGG - Intronic
921465228 1:215478733-215478755 AAGCAGAAAGAAGTGAGTGGGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921846099 1:219883986-219884008 AAGGACAAAGCATTGATCATTGG - Intronic
921959892 1:221023535-221023557 AAGGAGATAGAAGAGTTTGTAGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923062348 1:230487543-230487565 ATGGAGAAAACAGTGGTGGTTGG + Intergenic
923777296 1:236991018-236991040 GAGGAGAAAGAAGTGGTGGTAGG - Intergenic
923967515 1:239157789-239157811 AAGAAGAAAGGAGAGATGGTAGG - Intergenic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924481583 1:244439954-244439976 CAGGAGAATGCAGTGATCATAGG - Intronic
1064050768 10:12057591-12057613 AAGGAAAAAGAGGTGATCGTGGG + Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067380576 10:45769504-45769526 AAGGAGAACCCAGGGATTCTGGG + Exonic
1067532344 10:47083369-47083391 AAGCAGAAAGCAGGTATTGGAGG + Intergenic
1067791665 10:49292986-49293008 AAGGAGGAAGCACCGATTGCTGG - Intergenic
1067888274 10:50110156-50110178 AAGGAGAACCCAGGGATTCTGGG + Exonic
1068644089 10:59446244-59446266 TAGGAAAAAGCAGTATTTGTAGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1069742743 10:70695904-70695926 CAGGACAAAGAAGTGATTGCTGG + Intronic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1070486652 10:76938306-76938328 CAGGAGAAAGCAGTGTTGGGAGG - Intronic
1071108034 10:82121503-82121525 ATGAGGAAAGCAGTGAGTGTTGG - Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1072725865 10:97813529-97813551 AAAGAGAAGGCAGTGACTTTAGG + Intergenic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073387655 10:103140217-103140239 AAGAGCAAAGCAGTGATTGGAGG - Intronic
1074221671 10:111444343-111444365 GAGGAGAAACCAGTGGTTTTAGG + Intergenic
1074309850 10:112312720-112312742 GAGGAGGAAACAGTGACTGTGGG - Intergenic
1074368867 10:112882726-112882748 AAGGAGAAAGCTGGAATTCTAGG - Intergenic
1074386799 10:113023054-113023076 AAGGAGCAAGGAGACATTGTGGG + Intronic
1074487637 10:113902133-113902155 AAGGATGAAGCATTGATTATTGG + Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074765759 10:116698958-116698980 AAGGAGGGAGCAGTGAAGGTGGG - Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075666595 10:124234997-124235019 GAGGCGAAGGCAGTGAGTGTTGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1079527086 11:21403701-21403723 AAGGAGAGAGCAGTCTTTGATGG + Intronic
1079788761 11:24709796-24709818 AAAGAGAAAGCAGGAATTGCAGG + Intronic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080738205 11:35038183-35038205 AAGGAGATAGGAGGAATTGTGGG + Intergenic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081002156 11:37688338-37688360 ATAGAGAAAGAAGTGATTTTTGG + Intergenic
1081069324 11:38590554-38590576 AAGGAGCAAGCATAGATTTTAGG + Intergenic
1081981925 11:47272299-47272321 AAGGAGAAAGCAGTATTTTGAGG + Intronic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1082559353 11:54600422-54600444 AAGCTGAGAGCAGTGCTTGTAGG - Intergenic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1082852941 11:57781578-57781600 AAGGAGAAAGCAGGGCTTTAGGG - Intronic
1082933692 11:58634864-58634886 GAGGAGACAGCAGTGATAGCAGG - Intergenic
1083187734 11:61027183-61027205 GAAGAGGAGGCAGTGATTGTGGG - Intergenic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085286668 11:75366943-75366965 AAGGAGAAGGGGGTGGTTGTCGG + Intergenic
1085300870 11:75457575-75457597 AAGGGGAAAGCTGTATTTGTAGG - Intronic
1085316717 11:75549493-75549515 AAGGAGAAAGCAGAGAGAGAGGG + Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086800164 11:91163351-91163373 ATGAAGAAATCAGTGAATGTGGG - Intergenic
1087009248 11:93498188-93498210 AGGGACAAAGCATAGATTGTGGG - Intronic
1087020874 11:93601920-93601942 AAGGAGGAAACAGTGACTTTAGG + Intergenic
1087104412 11:94395838-94395860 AAGGAGAGAGGAGTAATTGCAGG - Intronic
1088045211 11:105443042-105443064 AAGGAGAAAGAAGAGATTAACGG + Intergenic
1088098378 11:106126402-106126424 TAGGAGAGAGAAGTGATTCTAGG + Intergenic
1088514676 11:110617850-110617872 CAGGAGAAAGCAGTGTATCTTGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1088949816 11:114556288-114556310 AAGGAGGAAACAGAGTTTGTAGG - Intronic
1089883921 11:121801160-121801182 AAGGAGGAAGCAGATAATGTAGG - Intergenic
1090064275 11:123489724-123489746 GAGGAGAAAGCAGGGATGATTGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090491279 11:127162978-127163000 AAGGAGCAGCGAGTGATTGTAGG - Intergenic
1091279541 11:134374182-134374204 AAGAAGAAAGCAGGTAATGTGGG - Exonic
1091565914 12:1647721-1647743 AGGGAGGAAGGAGTGATTGAGGG + Intergenic
1093014471 12:14142603-14142625 AAGGAGAAAGCAGTGTCTCCTGG - Intergenic
1093080491 12:14804756-14804778 AAAGAGAAAACAGTGTATGTTGG + Exonic
1093473835 12:19533537-19533559 AAGGAGAAATCAGTTATCTTAGG + Intronic
1093552026 12:20424252-20424274 AAGGAAAAAGTAGTGATTAATGG + Intronic
1094633897 12:32204808-32204830 AAGGGGAATGCAGTGATACTTGG + Intronic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095403913 12:41846225-41846247 AAGGCAAAAGCAGAGATTGGAGG - Intergenic
1095533691 12:43221417-43221439 TAGGAGAAAGCTGTGACTGCTGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096091617 12:48905735-48905757 AAGGAGAAGGCAGTAAATGGAGG - Intronic
1096271322 12:50167907-50167929 AGGGATAAAGCAGTGAAAGTAGG - Intergenic
1096679816 12:53248191-53248213 AAGGAAAAAGCAGTGTATGGTGG - Intergenic
1097559152 12:61180399-61180421 AAGAAGGAAGCAGGGATTCTTGG - Intergenic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099534509 12:83827803-83827825 AAGGGGAAAACAGGGATTCTAGG + Intergenic
1099731058 12:86502576-86502598 ACGGGGAAAGCAGTGTTTGGAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099904220 12:88752915-88752937 AAGGGGAAAGCACTGTATGTAGG + Intergenic
1100743232 12:97618257-97618279 TTGGAGAAAGCAGGGATTCTAGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1102437452 12:112936444-112936466 AAGGAGGGAGCAGTGAGGGTGGG - Intergenic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1104116847 12:125757898-125757920 AAGGAGGAAGAAGTGTGTGTTGG + Intergenic
1104654744 12:130565803-130565825 AAATAGAAAGCAGTGATTTCAGG + Intronic
1105909144 13:24844564-24844586 AATGAGCAAGCGGAGATTGTAGG + Intronic
1106035051 13:26036554-26036576 TAGGAGAAAGCTGTGGTGGTAGG + Intergenic
1106345292 13:28871239-28871261 AAGGAGATAGAAGGGCTTGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107929769 13:45297566-45297588 AAGAAGAAAGGAGACATTGTGGG - Intergenic
1108508674 13:51135705-51135727 AAGAAGAAAGAAGAAATTGTTGG - Intergenic
1108623290 13:52204540-52204562 CAGAAGAGAGCAGTGAGTGTTGG - Intergenic
1108663439 13:52606497-52606519 CAGAAGAGAGCAGTGAGTGTTGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109203546 13:59457241-59457263 AAAAAGGAAGCAGTGATTTTTGG + Intergenic
1109929396 13:69195197-69195219 CAGGAGAAAGAAGTGGATGTGGG - Intergenic
1110059335 13:71021852-71021874 AAGGAGAAAGTGGTTATTGCAGG + Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1113174836 13:107551033-107551055 AAGGACACAGCAGTGATTTCAGG - Intronic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113663111 13:112120399-112120421 AAGGAGAAAGGGGTGTTTCTGGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114574867 14:23703044-23703066 AAGGAGATAGGATTAATTGTGGG + Intergenic
1115292216 14:31785077-31785099 AAGGAGAAAGAATTGAATGGTGG - Intronic
1115565489 14:34621682-34621704 AAGGAGAAAACATAGAATGTAGG - Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1117464009 14:55974357-55974379 CAGGAGAATGCAGAGAATGTGGG + Intergenic
1117499315 14:56336533-56336555 AAAGAGAATGAAGTGATTATAGG - Intergenic
1118640650 14:67789238-67789260 AGGAAGAAAGCAGTTATTGGAGG - Intronic
1119119803 14:72064184-72064206 AAGGAGGAGGGAGTGATTTTTGG + Intronic
1119342931 14:73896002-73896024 AAGGAGAAAGTACTGATTTCTGG + Intronic
1120928921 14:89827574-89827596 ATGGAAAAAGCAGTGCATGTTGG - Intronic
1121883159 14:97518242-97518264 AAGGAGAAAGCAGTTGCTGAAGG - Intergenic
1124086561 15:26556029-26556051 AAGTAGAAAGAAGCGATTGTGGG + Intronic
1125120428 15:36152063-36152085 AAGGGGCAGGCAGTTATTGTTGG + Intergenic
1125810175 15:42533014-42533036 AAGGATCAAGCAGTGGTTATTGG - Exonic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1127922214 15:63503268-63503290 GAGGAGTAAGAAGTGATTGACGG + Intergenic
1127992591 15:64131825-64131847 AAGGAGGAAGAAGTCATTGTTGG - Exonic
1128187564 15:65656032-65656054 GAGGAGAAGGCAATGCTTGTGGG + Exonic
1128259744 15:66224896-66224918 AAGGAGAAATGAGTGCTTGGGGG - Intronic
1130007661 15:80116230-80116252 AGGGAGAAAACACTGATTTTTGG - Intronic
1130823325 15:87517948-87517970 AAGGAGACAGGAGTGTGTGTGGG - Intergenic
1130925886 15:88385487-88385509 AAGGACAAAGTACTTATTGTTGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1133619175 16:7510046-7510068 GAGGAGCAAGCTGTGATTGATGG + Intronic
1134796165 16:17038963-17038985 AAGGAGAATGTAGTGCATGTGGG - Intergenic
1135716517 16:24774226-24774248 AAGGAGTAAACAGTGAACGTAGG - Intronic
1137310972 16:47258083-47258105 AAGGGGAAAACAGTGAGTTTAGG + Intronic
1137560129 16:49497078-49497100 GAGGAGAAAGCAGTGATTTGTGG - Intronic
1138575756 16:57906459-57906481 AAGGAGGAAGCAGAGGTTGCTGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140810457 16:78572221-78572243 TAGGAGATAGCAGTGATAATGGG + Intronic
1141013333 16:80423951-80423973 AAGGAGAACGTAGAGACTGTGGG - Intergenic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145960599 17:28884574-28884596 AAGTAGAAAGAAGTGGTTGTGGG + Intronic
1146530539 17:33604309-33604331 AAGGAGAAAGGAGAGAAGGTAGG + Intronic
1149019870 17:51950569-51950591 GAAGAGGAAGCAGTGATTGGTGG - Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149370054 17:55985034-55985056 AGGGAGAAAGGAGTGATCATGGG + Intergenic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153755264 18:8276165-8276187 AAGGAGAAAACAGTGAGGGATGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792525 18:29992009-29992031 GATGAGAATGCAGTGATGGTAGG - Intergenic
1156860732 18:41833427-41833449 ATGGAAAAAGAAGTGACTGTTGG + Intergenic
1156869351 18:41927565-41927587 AAAAAGAAAGTAGTGATTTTTGG + Intergenic
1156871330 18:41948906-41948928 AAGAAGAAAGAAGTGCTTGTTGG - Intergenic
1157394569 18:47331010-47331032 GAAGGGAAAGCAGTGATGGTGGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157948966 18:52012809-52012831 AAGCAGAATGCAGTGAATTTTGG - Intergenic
1158716482 18:59884797-59884819 AAGGAGAATGGAGTGGTTGGTGG - Intergenic
1159106143 18:64003286-64003308 AATGACAATGCAGTGATTGATGG + Intronic
1159401862 18:67948455-67948477 AAGAAAAAAGAAGTGATTGAGGG - Intergenic
1159435286 18:68408564-68408586 CAGGAGAGAGCAGGGAGTGTGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1160079610 18:75712820-75712842 CAGGTGAAAGCAGTGAATGTTGG - Intergenic
1160615202 18:80121132-80121154 AAGGAGAAAAAAGTAAGTGTTGG - Intronic
1160825143 19:1076453-1076475 AGGTAGAAACCTGTGATTGTTGG + Intronic
1160919084 19:1511605-1511627 AAGGTAGAAGCAGTGATGGTGGG - Intronic
1161705298 19:5817772-5817794 AATGTGAAAACAGTGAATGTGGG + Intergenic
1161907933 19:7171194-7171216 AAGGAGAAAGGAGCCATTGAAGG + Intronic
1162616913 19:11809247-11809269 AAGGAGAAAGAATGGATTGGAGG + Intronic
1162905939 19:13824075-13824097 AGGGAGAAAGGAGAGATAGTAGG + Intronic
1164019830 19:21290779-21290801 AAGGAGAATGGCGTGAATGTGGG + Intronic
1165325173 19:35110161-35110183 AAGGAGAAGGAAGACATTGTGGG + Intergenic
1165819772 19:38666947-38666969 AAGGAGAAAGAACTGAGTCTAGG + Intronic
1166805800 19:45486130-45486152 AAGGTGAAAGAAGGGATTGGAGG + Intronic
1168292689 19:55364491-55364513 AAGGAGAGAGGTGGGATTGTGGG - Exonic
1202714814 1_KI270714v1_random:36334-36356 GAGGAGAAATCAGTGAGTGGGGG - Intergenic
926377009 2:12240642-12240664 AAGGAGAAAGAATAGACTGTGGG - Intergenic
928271971 2:29864525-29864547 AAAGAGAAAGATGTGATTCTTGG - Intronic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930381089 2:50630315-50630337 AAGTAGAAATCAGTGATTCTTGG - Intronic
930606188 2:53495908-53495930 AAGGATAATGCAATGAGTGTTGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
931325639 2:61219316-61219338 TAGGAGAAATCACTGATTTTAGG - Intronic
931750555 2:65326342-65326364 AAGGAGAAAGGACTGATCATAGG - Intronic
932888984 2:75573993-75574015 AAGGAGAAAGCAATCATTAGGGG + Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
933632086 2:84670742-84670764 AAGGGGAAATCAGTGCATGTTGG - Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935805632 2:106744835-106744857 AAGGAAAATGAAGTGAGTGTTGG - Intergenic
936237169 2:110752525-110752547 AGAGAGAAAGTAGTGATTGAGGG + Intronic
936821525 2:116527836-116527858 AAGGTGAAGGCAGAGATTGGAGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938120102 2:128627069-128627091 AAGAAGAGACCAGTGATTCTTGG - Intergenic
938404865 2:131026099-131026121 AAGGACAGAGCAGACATTGTAGG + Intronic
939122576 2:138135882-138135904 AAGGAGAAAACCGTGACTTTAGG - Intergenic
939560316 2:143723858-143723880 AATTAGAAAGCAGTATTTGTGGG + Intronic
940066608 2:149637099-149637121 AAGGAGAAATCAATTGTTGTGGG - Intergenic
940242808 2:151581182-151581204 AAGGAAAAAGCAATGATGGATGG + Intronic
940243766 2:151591733-151591755 AAGGAAAAAGCAATGATGGATGG + Intronic
940244722 2:151602286-151602308 AAGGAAAAAGCAATGATGGATGG + Intronic
940575232 2:155495162-155495184 ATTGAGAAAGCAGTGGTTCTTGG + Intergenic
940798762 2:158109282-158109304 AAGGAAATAGGAGTGATTGCTGG - Intronic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941748119 2:169108875-169108897 AAGGAGAAAAGAGGGATTCTTGG - Intergenic
942804272 2:179911336-179911358 AAGGAGAAAGCAGTCTTACTTGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942925042 2:181421403-181421425 AAGGAGAAAGAAATGAGTGATGG + Intergenic
943640743 2:190355008-190355030 AAGGGAAAATCAGTAATTGTTGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944135809 2:196398073-196398095 AAGGGGAAAAAAGTGAGTGTAGG + Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
944961422 2:204878971-204878993 AAGCAGAAAGCTGTAATTGTTGG + Intronic
945877714 2:215295825-215295847 AAGGAGAAACCACTGAATTTTGG - Intergenic
945944295 2:215980183-215980205 CAGGAGAAAGCAGTGCCTGGAGG - Intronic
946073932 2:217058034-217058056 AAGGAGAAAAGAGTGAATGATGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948959010 2:241316846-241316868 AAGGAGAAGGCAGTTAAGGTGGG - Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168888246 20:1275339-1275361 CAGGAGGAAGCAGTGTTCGTGGG - Intronic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170360525 20:15541106-15541128 AAAGATAAACCAGTGTTTGTGGG + Intronic
1173303294 20:41823596-41823618 AAGCAGAAAGCAAGGATTGAAGG - Intergenic
1173696385 20:45018316-45018338 AAGTAGAAAAGAGTCATTGTAGG + Intronic
1174212304 20:48889787-48889809 AAGAAGAAGGCAATGACTGTTGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175758742 20:61546966-61546988 AAGCAGACAGCAGTGATGGGCGG + Intronic
1175862299 20:62156887-62156909 AAGGAAAAAGCAGTGCCTTTTGG - Intronic
1175889255 20:62309092-62309114 AAGGAGGAACCAGTGATGATTGG + Exonic
1176657064 21:9596575-9596597 AACGATAATGCACTGATTGTTGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178477728 21:32952062-32952084 AGGGAGAAAGCAGTGAGAGCCGG + Intergenic
1179802719 21:43818832-43818854 AAAGACAAGGCAGTGAATGTTGG - Intergenic
1181098144 22:20520203-20520225 TGGGTGAAAGCAGTGCTTGTAGG + Intronic
1182536310 22:31006156-31006178 TTGGAGAAATCAGTGATTCTAGG + Intergenic
1183286118 22:36965319-36965341 AAGGAGAAAGCAGAGTGTGGTGG - Intergenic
1185168605 22:49277738-49277760 AAGTAGAAACCAGTGACGGTGGG + Intergenic
950454196 3:13082935-13082957 AAGGAGCCAGCAGTGAGTGTGGG - Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951612693 3:24509151-24509173 AATGAGAAAGCAGGGCTTATAGG + Intergenic
953181587 3:40599924-40599946 AGGGAGAAAGCAGAGGTTTTTGG + Intergenic
953275355 3:41490505-41490527 AAGAAGAAAGTAGTGAGTGGAGG - Intronic
954595707 3:51822327-51822349 AAAGAGAAAATAGTGAATGTTGG - Intronic
954770897 3:52967466-52967488 AATTAGATAGCAGTGATGGTTGG + Intronic
955346590 3:58166201-58166223 AAAGAGAAAGCAGGGGTTATGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957437878 3:80202069-80202091 AAGGAGAAAGGACAAATTGTGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958065662 3:88542306-88542328 ACAGAGAAAGCAGAGATTGATGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959011243 3:101078878-101078900 AAGGAGACACCAGTGGTAGTTGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960786908 3:121383579-121383601 AAGGAGAAAGCCATGAGTCTGGG + Intronic
960827542 3:121806563-121806585 AAAGAGAAAGCAGTAATTCCAGG - Intronic
960845187 3:121998336-121998358 GAGGAGTAAGGAGTTATTGTTGG - Intronic
961100532 3:124194945-124194967 GAAGAGAAGGCAGTGATGGTAGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
962060334 3:131920140-131920162 TAGGAAAAATCAGTGATTCTAGG - Intronic
962160192 3:132990752-132990774 AAGGAGACAGCAGGGAGTGAGGG - Intergenic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962564719 3:136646042-136646064 CATGAGAAAGCTGTGAATGTTGG - Intronic
962979437 3:140474367-140474389 CAGGAGCAAGCAGTGAATGGGGG - Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964475570 3:157095111-157095133 AATGGGAAAGCAGGGATTATAGG + Intergenic
964642776 3:158927851-158927873 AAAGAGATAGCAGTTATTATTGG - Intergenic
965673887 3:171174472-171174494 AAGGAGGAAGCAATGAATTTTGG + Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967702629 3:192611199-192611221 AAGCAGAAAGCAGAGCTTCTAGG - Intronic
968936305 4:3612253-3612275 CAGGAGGAGGCAGTGACTGTGGG + Intergenic
969855501 4:9995994-9996016 ACAGAGAAAGCATTGTTTGTGGG + Intronic
970038979 4:11774278-11774300 AATGAGAAAGCAGAGTTTGAAGG + Intergenic
970747361 4:19315518-19315540 AAGCAGAGAGCAATCATTGTAGG - Intergenic
971247662 4:24944944-24944966 AAGGAGAAAGGAGGGTTTGTGGG - Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972726444 4:41749928-41749950 AAGGAGCGAGCAGTGATTTGTGG + Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975567456 4:75773705-75773727 AAGGTGAAAACAGTTATTTTTGG - Intronic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
976821807 4:89215216-89215238 ATGAGGAAAGCAGTGATTCTCGG - Intergenic
977167004 4:93711698-93711720 ATGGAAACAGCACTGATTGTGGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981228872 4:142329380-142329402 AAGGGGAAAGAAGTGAAAGTTGG + Intronic
982034735 4:151334527-151334549 AAGGAGAAAACAGATATTGGGGG - Intergenic
982077649 4:151753897-151753919 ATGGAGGAAGAAGTGAGTGTGGG - Intronic
982102129 4:151978333-151978355 AAGGAGATAGCAGAGACAGTTGG - Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
982941225 4:161559294-161559316 AAGGAAACAGCAGTTATTTTAGG - Intronic
982993109 4:162304720-162304742 AGAGATAAAGCAGTGATTTTAGG + Intergenic
983306857 4:166000865-166000887 AAGAAGAAAGAGGTGATTGGTGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985341578 4:188960310-188960332 AAGGAGAAAGAAGTGAAGGATGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
988481218 5:31632494-31632516 AAGGAGAAACCAGAGAATGAAGG - Intergenic
988640855 5:33039859-33039881 AAAGAGAAAGCAGGGGTTGTGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991476974 5:67032220-67032242 CATTAGAAAGCAGAGATTGTGGG - Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993472952 5:88328956-88328978 AAGGAGAAGGCAGTGAGTAGGGG + Intergenic
993995234 5:94714766-94714788 AAGGATAAAGAAGTGAGTGACGG - Exonic
995192865 5:109338016-109338038 AAGGAGAAAGCAGTTATACTAGG + Intronic
995264709 5:110144686-110144708 AAGGAGAAGACAGTGATTAGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995443184 5:112214354-112214376 AATGAAAAAGCAGTGGTGGTGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995711237 5:115037966-115037988 AAGGGGAAAGCAGGGACTATGGG - Intergenic
996111890 5:119575379-119575401 AAGGGGAAAAGAGTGATTCTGGG + Intronic
996582245 5:125044422-125044444 AAGGAGAACGAAGTGGATGTTGG - Intergenic
997416515 5:133732689-133732711 AAGAGGAAAGCAGTGGTAGTGGG - Intergenic
997499547 5:134361988-134362010 AAGGCAAAAGCAGTGAAAGTAGG + Intronic
997713657 5:136027040-136027062 AAGGAGAAGGGAGAGAGTGTGGG - Intergenic
998416916 5:141952830-141952852 GAGGAGGAAGCAGTGTTTCTAGG - Intronic
1000475205 5:161698328-161698350 CTGGAGAAATCAGTGATGGTAGG + Intronic
1001135745 5:169101168-169101190 AAGAAGAAAGCCATGAATGTGGG + Intronic
1002276122 5:178105279-178105301 AAGGAGAGAGCGGTGCTTGTGGG + Intergenic
1003249709 6:4415498-4415520 AAGGGGAATGCAGTAATTCTTGG + Intergenic
1003383887 6:5649857-5649879 GAGTTGAAAGCAGTAATTGTTGG + Intronic
1003674741 6:8192785-8192807 AAGGAGAAAGGAGAGAAGGTGGG + Intergenic
1004541572 6:16555180-16555202 AAGGATGAAGGAGTGTTTGTAGG - Intronic
1004812859 6:19278562-19278584 AAGCAGAAAGTAGTAAGTGTTGG - Intergenic
1005497628 6:26402290-26402312 AAAAAGAAAGCAGAGACTGTCGG - Exonic
1006710507 6:36065139-36065161 AAGGAGTAAACAGTGACAGTAGG - Intronic
1007051369 6:38834036-38834058 AAGCAGAAAGCAGTGTCTGGTGG - Intronic
1007301859 6:40873780-40873802 AAGAAGAAAGGAGTGACTGATGG + Intergenic
1007533880 6:42567055-42567077 GTAGAGAAAACAGTGATTGTAGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008617732 6:53242387-53242409 AAGGAGAAAGCAGATACCGTGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009974890 6:70662020-70662042 TAGGAGCAAGCAATGATTATAGG - Intergenic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010756499 6:79671477-79671499 TAGGTGAAAGCAGTGACTGTTGG + Intronic
1011029163 6:82902581-82902603 AAGGACAGAGCAGTGATTGCAGG + Intronic
1011709198 6:90034287-90034309 TAAGAGAAAGCAGTGACTATGGG - Intronic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013068142 6:106703652-106703674 GAGAATAAAGCAGTGATGGTGGG + Intergenic
1013434107 6:110084349-110084371 GAGGAGGAAGCAGCTATTGTGGG - Intergenic
1014072300 6:117196899-117196921 AGGGAGAAAGCTGGGATTGCAGG - Intergenic
1014723298 6:124945732-124945754 AAAGAGACAGCACTGATAGTTGG - Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1014795099 6:125715561-125715583 AAGGTGAAAGCAGAGAATGGGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015925394 6:138304920-138304942 AAGGATCAAGCAGAGATTATTGG - Intronic
1016354084 6:143198892-143198914 AAGGAGAAAAGAGAGATTGTGGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017235206 6:152111499-152111521 ATTGAGAAATCAGTAATTGTGGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1022195212 7:28058709-28058731 CAGGACAAAGCAGAGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022554096 7:31274525-31274547 AAGGAGGAACAAGAGATTGTGGG - Intergenic
1022953954 7:35364391-35364413 AAGGTGAAAGGAGGGAATGTGGG - Intergenic
1023481981 7:40644370-40644392 ATCCAGAAAGCAGTGATTGAGGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024427360 7:49241871-49241893 AATAACAAAGCAGTCATTGTAGG + Intergenic
1024867905 7:53925072-53925094 AAGGTGATAGCAGTGATAGATGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025606472 7:63043473-63043495 AAGGAGAAAGCGGTGCAGGTGGG - Intergenic
1026328950 7:69335556-69335578 GAGGAGAATGCAGGAATTGTTGG - Intergenic
1026420358 7:70230480-70230502 AAGCAGAAGGCAGTGATTTAGGG - Intronic
1026902567 7:74045193-74045215 GGGGACAAAGCAGTGAGTGTAGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027875604 7:83763976-83763998 AAGGAGAAAGCACTGGATGTAGG + Intergenic
1028104175 7:86857771-86857793 GAGGAGAAACCAGTGATGTTGGG + Intronic
1028124749 7:87099994-87100016 AACAAGAAAGCAGAGATTGGGGG - Intergenic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1030176963 7:106664492-106664514 AAGGAGATAGCATTAATTGCTGG + Intergenic
1030264362 7:107603512-107603534 AAAGAGAAAACAGTAATTGGGGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1032324597 7:130915327-130915349 AAAGAAAAAGCAGTGATTACAGG + Intergenic
1032669179 7:134067812-134067834 AGGTAGAAAGAAGTGCTTGTGGG - Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1036561161 8:9901568-9901590 AAGAAGAAAGCAGTCAGTGCTGG - Intergenic
1036778464 8:11629491-11629513 AAGGAGAAAGCGGTGCAGGTGGG + Intergenic
1037034776 8:14152989-14153011 AAGAACAAATAAGTGATTGTCGG + Intronic
1037858548 8:22388698-22388720 AGGGAGAAAGCAGAGGATGTGGG + Intronic
1037940026 8:22944314-22944336 AAGGAGCAGGATGTGATTGTTGG + Intronic
1040304694 8:46205964-46205986 AATGAGAAAGCAGGGAATGCTGG + Intergenic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1042822959 8:72952016-72952038 AAGGAGAAAGGGCTGGTTGTAGG + Intergenic
1042954617 8:74236521-74236543 AATGAGATAGGAGTGAATGTTGG + Exonic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045638608 8:104222929-104222951 AAAGAGAAAGCTTTAATTGTAGG + Intronic
1046634103 8:116653050-116653072 AAGGGGAAAGCAGTGACAGTAGG + Intronic
1046687412 8:117243098-117243120 AAGGAGAAAGCAGTTAGTCCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047273495 8:123386034-123386056 AAGGAGAAAATAGCAATTGTTGG + Intronic
1047681297 8:127257246-127257268 AAGGAGTAAGAAGTGGCTGTTGG + Intergenic
1047996704 8:130343366-130343388 AGGGAAAAAGGAGTGAGTGTGGG - Intronic
1048821290 8:138382958-138382980 ATGGAAACAGGAGTGATTGTAGG + Intronic
1048874554 8:138826918-138826940 AAGGAGAAGGCAGTGAAGGCAGG - Intronic
1049570524 8:143368329-143368351 GAGAAGAAAGCAGGCATTGTCGG + Intergenic
1050694029 9:8259636-8259658 AGGGAGAAAGCAATGATTTGTGG + Intergenic
1050847722 9:10244076-10244098 TAGTAGTAAACAGTGATTGTAGG - Intronic
1050900936 9:10947813-10947835 AATAAGAAAGCAGGGGTTGTGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051229920 9:14945379-14945401 AAAGAGAAAGCAGTGATTATGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051872569 9:21755657-21755679 ATGAAGAAAGTATTGATTGTGGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052413462 9:28149188-28149210 GAGGAGAAAGAAGAGATGGTAGG + Intronic
1052751305 9:32494241-32494263 AAAGACAAATCAGGGATTGTAGG - Intronic
1055705438 9:78995527-78995549 AATTAGATAACAGTGATTGTTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057317046 9:93976185-93976207 AGGAACAAAGCAGTGATTCTGGG - Intergenic
1057573839 9:96224069-96224091 AAGGGGAAAACAGAGAGTGTGGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058290285 9:103232732-103232754 AAAGGAAAAGCAGTGTTTGTAGG - Intergenic
1058499959 9:105603291-105603313 AAGTAGAAAGCACTGACTGAGGG - Intronic
1058522918 9:105829442-105829464 AGGGAGACAGCACTGATTGCAGG - Intergenic
1058754960 9:108075711-108075733 AGGGAGACAGCATTGATTCTGGG + Intergenic
1059480768 9:114587741-114587763 AAGGAGCAAGCGCAGATTGTGGG + Exonic
1059554785 9:115268898-115268920 TACTAGAAAGCAGTGATTATTGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1061592745 9:131608551-131608573 AAGGAGAAAGCAAGGAGAGTCGG + Intronic
1062051690 9:134450581-134450603 ATGGGGAAGGCAGTGAGTGTGGG + Intergenic
1062145616 9:134988183-134988205 ATGGAGAAAGCAGGGAGGGTGGG - Intergenic
1203634788 Un_KI270750v1:100149-100171 AATGATAATGCACTGATTGTTGG - Intergenic
1187549571 X:20288512-20288534 AAGGAAAATGGAGTGTTTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188013638 X:25084173-25084195 CAGGAGAAAGCAATGACTGCAGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188539447 X:31233193-31233215 CAGGAGAGAGCAGTGACTGAAGG - Intronic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188895617 X:35664881-35664903 AAGGAGTAAGCAGAGATAGCAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1189297283 X:39927947-39927969 AAGGAGAAAGCTGTGAATGCTGG + Intergenic
1189316706 X:40061968-40061990 AAAGAGACAGCAGTGAGAGTGGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1189667762 X:43375670-43375692 AATGAGAAAGCATTGCTGGTTGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190834362 X:54086773-54086795 AAGAAGAAAGCAGTCATAGATGG + Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192843385 X:74880829-74880851 AAGGAGAGAGCAGTGTATATGGG - Intronic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195463582 X:105155279-105155301 GAGGAGCAAGCTGTCATTGTTGG + Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1198050783 X:132951407-132951429 AAGAAGAAAGGAGGCATTGTGGG - Intronic
1198134810 X:133738313-133738335 AGGGAGAAAGCAATGACAGTGGG - Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic