ID: 1082835363

View in Genome Browser
Species Human (GRCh38)
Location 11:57647152-57647174
Sequence CCGTCTCTGCGGGGGCTGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082835363_1082835370 -5 Left 1082835363 11:57647152-57647174 CCGTGCAGCCCCCGCAGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1082835370 11:57647170-57647192 GACGGTCGCAGGTGAAGCAGCGG 0: 1
1: 0
2: 0
3: 3
4: 79
1082835363_1082835372 5 Left 1082835363 11:57647152-57647174 CCGTGCAGCCCCCGCAGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1082835372 11:57647180-57647202 GGTGAAGCAGCGGAGCAGGTTGG 0: 1
1: 0
2: 0
3: 18
4: 246
1082835363_1082835374 24 Left 1082835363 11:57647152-57647174 CCGTGCAGCCCCCGCAGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1082835374 11:57647199-57647221 TTGGCTAGAGCCGTGTTTCAGGG 0: 1
1: 1
2: 0
3: 7
4: 86
1082835363_1082835373 23 Left 1082835363 11:57647152-57647174 CCGTGCAGCCCCCGCAGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1082835373 11:57647198-57647220 GTTGGCTAGAGCCGTGTTTCAGG 0: 1
1: 0
2: 3
3: 2
4: 60
1082835363_1082835375 28 Left 1082835363 11:57647152-57647174 CCGTGCAGCCCCCGCAGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1082835375 11:57647203-57647225 CTAGAGCCGTGTTTCAGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1082835363_1082835371 1 Left 1082835363 11:57647152-57647174 CCGTGCAGCCCCCGCAGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1082835371 11:57647176-57647198 CGCAGGTGAAGCAGCGGAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082835363 Original CRISPR CCGTCTCTGCGGGGGCTGCA CGG (reversed) Exonic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900524474 1:3121763-3121785 CCTTCTCTGCGGGGCCGGCCAGG + Intronic
903322421 1:22551064-22551086 CCATCTCTGCCCAGGCTGCAGGG + Intergenic
903492943 1:23743411-23743433 CCGTCTCCGCCGGGGATGCACGG + Exonic
904340463 1:29830758-29830780 CCCTCTCCCCGGGGTCTGCAGGG + Intergenic
904424491 1:30414743-30414765 GAGTCTCTGTGGAGGCTGCAGGG - Intergenic
904701674 1:32361828-32361850 CCGACCCTGCGGGGGCTCCTGGG + Exonic
906208059 1:43997488-43997510 CAGTCTCTGCGGTGGGAGCACGG + Intronic
910223868 1:84916780-84916802 CCATCTCTGCAGGGTCTGGATGG + Intergenic
912272972 1:108229142-108229164 CCGCCTCGGTGGGGGCTGAAAGG + Exonic
912295247 1:108465180-108465202 CCGCCTCGGTGGGGGCTGAAAGG - Exonic
912332809 1:108834895-108834917 CTGTGTCTGCTGGGGCTCCAGGG + Intronic
914977540 1:152379978-152380000 CCATCTCAGGGGAGGCTGCAAGG - Intergenic
915924346 1:160004713-160004735 CTGACTCTGGGGGGGCAGCAGGG - Intergenic
916031239 1:160879286-160879308 GAGTCTCTGTGGGGACTGCAGGG - Intronic
920258435 1:204672575-204672597 CCGTCTTGGAGGAGGCTGCATGG + Intronic
921053440 1:211527032-211527054 CTGTCTGGGTGGGGGCTGCAGGG - Intergenic
922619904 1:226983058-226983080 CTGTCCCTATGGGGGCTGCAAGG + Intronic
924741935 1:246799243-246799265 TGGTCTGTGCAGGGGCTGCAGGG + Intergenic
1064185910 10:13161670-13161692 ACGTCTCTGCGCGGGTTGCAAGG + Intronic
1065625792 10:27627103-27627125 TCGTCACTGCCGGGGCTGCCGGG + Intergenic
1072627752 10:97124487-97124509 TCTCCTCTGCGGAGGCTGCAGGG + Intronic
1072660193 10:97359080-97359102 CCCTCTCTGAGAGAGCTGCAAGG + Intronic
1074922095 10:118024926-118024948 CCATCTCTGCAGAGGCTTCAAGG + Intronic
1076688103 10:132207239-132207261 CCGGCACTGCGGTGGCTCCACGG + Intergenic
1076691612 10:132226558-132226580 CAGTCTCAGCTGGGGCTGCTGGG + Intronic
1076806923 10:132863340-132863362 CAGCCTCTGCTGGGGCCGCAGGG - Intronic
1077541257 11:3147504-3147526 CCGTCCCAGCTGGGCCTGCACGG - Intronic
1078222696 11:9364647-9364669 CCAGCTCGGCGGGGGCCGCACGG + Intergenic
1081527170 11:43935044-43935066 CAGCCTGTGCCGGGGCTGCAGGG - Intronic
1082835363 11:57647152-57647174 CCGTCTCTGCGGGGGCTGCACGG - Exonic
1083186414 11:61020284-61020306 GCCTCTCTCTGGGGGCTGCACGG - Exonic
1084083887 11:66845929-66845951 CCGCCTCTGTGGGTGCTCCAAGG - Exonic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1089784211 11:120896420-120896442 CCATCTCTGCAAGGGCAGCATGG - Intronic
1091278401 11:134368016-134368038 CCGTCTTTCCGGGGGCTGAGGGG - Intronic
1094319011 12:29164572-29164594 CCGTCTCTGCAGGGCCAGCCGGG - Intronic
1095461194 12:42446094-42446116 CCGTTTCTTCCGGGGCTGCAGGG - Exonic
1101675490 12:106913233-106913255 GCGGCTCTGTGGGGGCAGCAGGG - Intergenic
1103465312 12:121137848-121137870 CTGTCCCTACTGGGGCTGCAAGG + Intronic
1103539341 12:121655028-121655050 CCGGCGCTGTAGGGGCTGCATGG - Intronic
1104594554 12:130112317-130112339 CCGTCTCTCCAGGGTCAGCAAGG - Intergenic
1104901489 12:132191774-132191796 CCCCCTCTGAGAGGGCTGCAGGG - Intergenic
1104929185 12:132329299-132329321 CCGGGGCTGCGGGGGCTGCGGGG + Intronic
1107885346 13:44870493-44870515 TCTTCTCTTTGGGGGCTGCAAGG + Intergenic
1108521715 13:51252133-51252155 CCCTCGCTGATGGGGCTGCAAGG - Exonic
1112369066 13:98778947-98778969 TCGTCACTGCGGGAGATGCAGGG + Intergenic
1120443568 14:84566293-84566315 CCGTCTCAGGAGAGGCTGCAAGG - Intergenic
1121098547 14:91234135-91234157 CCGCCTCCGCGGGGCCTGCCTGG - Exonic
1122282966 14:100635111-100635133 GGGTCTCTGCAGGGGCTGAAAGG + Intergenic
1122593187 14:102870411-102870433 CCGCTTCTGCGAGAGCTGCATGG + Exonic
1122774616 14:104111728-104111750 CAGTCTGTGCGGGTCCTGCATGG - Intronic
1122814358 14:104305019-104305041 CCGACTCAGGGGTGGCTGCAAGG + Intergenic
1125931784 15:43605278-43605300 CCCTCTCTGCCAGGGCTGCCTGG + Exonic
1125944884 15:43704756-43704778 CCCTCTCTGCCAGGGCTGCCTGG + Intergenic
1127512574 15:59657335-59657357 CCGACTCCGGGGGGGCGGCAGGG + Intronic
1127642576 15:60929817-60929839 CCGTATCTCTGGGGGCTGGAGGG - Intronic
1129384584 15:75188889-75188911 AGGTCTGTGCAGGGGCTGCAGGG + Intergenic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1132501270 16:285798-285820 GGGCCTCTGCGGGGCCTGCAGGG - Intronic
1132514949 16:361908-361930 TCCTCTCAGCAGGGGCTGCAAGG - Intergenic
1132573392 16:653764-653786 CCTTCTCTGCGGGGTTGGCAAGG + Exonic
1132653047 16:1030281-1030303 GCATCTCTCCCGGGGCTGCAGGG - Intergenic
1136398885 16:30007152-30007174 CGGTCTGTGTGGGGGCTGCAGGG - Exonic
1137581434 16:49635863-49635885 CGGCCTCTGCGCCGGCTGCATGG - Exonic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1141618369 16:85222706-85222728 CCGTCTCTGCGTGGACTGCCGGG + Intergenic
1141841025 16:86574213-86574235 CATTCCCTGCCGGGGCTGCATGG - Intergenic
1141949526 16:87331653-87331675 CTGTCTCTGCAGGGGCAGCTGGG + Intronic
1142176322 16:88647058-88647080 GGGTCTCTCCGGGGGCTGCGGGG - Intronic
1142933686 17:3309845-3309867 ACGTGTATGCGGGGGGTGCAGGG + Intergenic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1144301229 17:13924291-13924313 CCGTCTCAGGGAAGGCTGCAAGG + Intergenic
1145292978 17:21564518-21564540 CCTTCTCTGTTGGGGCTTCATGG - Intronic
1146297011 17:31658164-31658186 CCTGCTCTGAGGGGGCTGCCAGG + Intergenic
1148555099 17:48573951-48573973 CCGTCTCTCCCGGATCTGCAAGG - Intronic
1151786472 17:76277408-76277430 GCTTCTCTTCGGGGGCTGCCGGG + Intronic
1156450033 18:37261710-37261732 GCGGCTCTGCCAGGGCTGCAAGG - Intronic
1157704669 18:49794287-49794309 CCATCTCTGCTGTGACTGCAGGG + Exonic
1160523870 18:79524301-79524323 CCGTGTCTGCGGGGCGAGCACGG + Intronic
1160719421 19:590757-590779 CCGCCTCTGGGGGGGCTCCCCGG + Intronic
1161283843 19:3459001-3459023 CCCTCTCTCCGGGGTCTGCAGGG - Intronic
1162390419 19:10386391-10386413 CTGGCTCTGCAAGGGCTGCAGGG + Intergenic
1163466486 19:17470891-17470913 GGGTCTCTGAGGGGGCTACAGGG + Intronic
927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG + Intergenic
929948151 2:46386021-46386043 CCGGCTGAGTGGGGGCTGCAGGG - Exonic
931638611 2:64362258-64362280 CTGTCAGTGAGGGGGCTGCAAGG - Intergenic
934573563 2:95386309-95386331 GGGTCTGTGCGGAGGCTGCAGGG - Intergenic
935321510 2:101893931-101893953 CCTTCTCGGCGGGGGCTTCCTGG + Intronic
937235831 2:120431533-120431555 CTGTCCCTGTGGAGGCTGCATGG + Intergenic
938034666 2:128026958-128026980 CGGTCTCAGCGGGGGCTTCGCGG - Intronic
938639801 2:133266590-133266612 CCTTCACTTCGGGGGCAGCAAGG + Intronic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
942653809 2:178194629-178194651 CGGACTCTGCGGCGGCTGCGCGG - Exonic
949048161 2:241881752-241881774 CCCTGTGTGCGGGGGCTGGACGG + Intergenic
949052363 2:241904007-241904029 CCTTCTCTGCGGGGCCTTCTGGG - Intergenic
1170598412 20:17822653-17822675 GGGTCTGTGCGGTGGCTGCAGGG - Intergenic
1172765077 20:37346624-37346646 CCGCCTCTGCCTGGGCTGCCCGG + Intronic
1173253658 20:41377658-41377680 TAGCCTCTGCGGTGGCTGCAAGG + Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1175248261 20:57594149-57594171 CAGTCCCTGCAGGGGCTGCCAGG - Intergenic
1175396692 20:58669313-58669335 CCGGCTCGGCAGGGCCTGCACGG - Exonic
1175966094 20:62660918-62660940 CCGGGGCTGCGAGGGCTGCAGGG + Intronic
1179245980 21:39634636-39634658 GCATCCCTGCAGGGGCTGCAGGG + Intronic
1180074272 21:45454858-45454880 CCGTCTCTGCTGGGTCTCCTGGG + Intronic
1180669587 22:17542745-17542767 CAGGCTCTTCGGGGGGTGCAGGG + Exonic
1181734967 22:24874445-24874467 CCGTCTCTGTGGGCCCTGCCTGG + Exonic
1183704797 22:39469833-39469855 CTGGCACTGCCGGGGCTGCAGGG + Intronic
1183721949 22:39567783-39567805 CCATCTCTCCAGGGGCTGAAGGG - Intergenic
1184273373 22:43397224-43397246 CCCTCACTGCGAGGGGTGCAAGG + Intergenic
1184448637 22:44569731-44569753 CCGGTTTTCCGGGGGCTGCAAGG + Intergenic
1184595029 22:45508682-45508704 CTGCCTCTGCAGAGGCTGCATGG + Intronic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
952706258 3:36380653-36380675 CCGTCCTCGCGGGGGCTGCTCGG - Exonic
961378637 3:126483021-126483043 CCATCTCACCGGGAGCTGCAGGG - Intronic
961394548 3:126578081-126578103 CAGCCTCTGCTGGGGCAGCATGG + Intronic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
965404159 3:168249621-168249643 CCGGGGCTGCGGGGGCTGCTGGG + Intergenic
967959508 3:194909184-194909206 CCGCCTCTGCTGGGCCTGGAGGG - Intergenic
968047184 3:195631009-195631031 CTCTGTCTGTGGGGGCTGCAGGG + Intergenic
968307417 3:197658855-197658877 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307431 3:197658915-197658937 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307449 3:197658975-197658997 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307463 3:197659035-197659057 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
969599565 4:8167991-8168013 CTCTCTCTGCTGGGGCTGCTGGG - Intergenic
971024149 4:22571513-22571535 GCTTTTCTGCGGGGGCAGCAGGG + Intergenic
971617611 4:28812781-28812803 AAGTCTCTGCGGGTGCTTCAGGG + Intergenic
972266403 4:37464255-37464277 CCGTCTCTTCTGGGGCAGCCAGG - Intronic
981128562 4:141133185-141133207 CCGTCCCCGCCGGGGCTGGAGGG - Intronic
982435166 4:155376782-155376804 CCGGCTCTGCGGGCGCCGCCAGG - Exonic
985103003 4:186476487-186476509 TGGGGTCTGCGGGGGCTGCAGGG - Intronic
985575321 5:671068-671090 CCGGCTGTGTGGGGGCTTCATGG - Intronic
985744418 5:1638120-1638142 CCCTGTCTGTGGGGGCTGCAGGG - Intergenic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
991964703 5:72079508-72079530 CCGTGTCCCCGGGGACTGCAGGG - Intergenic
993036284 5:82761029-82761051 CCGACACTGCGGGGGCTACACGG + Intergenic
993038077 5:82779474-82779496 CTATCTCTGTGGGGGCTTCAGGG - Intergenic
993307586 5:86290819-86290841 CCGCCTCGGTGGGGGCTGAAAGG - Intergenic
994742904 5:103643453-103643475 CTGTCTCTAGGGGGGCTCCAAGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997963289 5:138338425-138338447 CCGCCTCTGCGGGGAGAGCACGG + Intronic
1002029279 5:176416192-176416214 CCGGCTGCGCGGGGGCCGCATGG + Exonic
1003175861 6:3751870-3751892 CGGTCTCTGCGGAGGCGGCGGGG - Exonic
1007484747 6:42173337-42173359 CAGTCTCCCCTGGGGCTGCAAGG + Exonic
1019492574 7:1322140-1322162 CCGTCTCTGGGGGGCGTGCAAGG + Intergenic
1020009208 7:4799365-4799387 CCCTCTCTAGGGGGGCTGCGAGG - Exonic
1020281636 7:6653105-6653127 CCGACGCGGCGGGGGCTGCGCGG + Exonic
1022088150 7:27088448-27088470 CCGGCTCTGCTGGGGCTGCGGGG - Intergenic
1023718980 7:43073394-43073416 GTGTCTCAGCGGGGGTTGCATGG + Intergenic
1035635244 8:1139301-1139323 CTGTCTCAGCTGAGGCTGCAGGG + Intergenic
1038030920 8:23638425-23638447 CAGTCTCTCTGGAGGCTGCAGGG - Intergenic
1045638771 8:104223695-104223717 CCGGCTCTGGGAGCGCTGCATGG - Intronic
1046600233 8:116307684-116307706 ACGTCTCTCAGGGTGCTGCATGG - Intergenic
1049096302 8:140550302-140550324 CCCGCTCTGTGGGGGCAGCAGGG - Intronic
1050780790 9:9332029-9332051 CCCTCTCTGCGGAGTCTGCATGG + Intronic
1052903831 9:33817315-33817337 CGTTCTCTTCGGGGGCCGCAGGG - Intergenic
1055375716 9:75646972-75646994 CCATCTCAGGGGAGGCTGCAAGG - Intergenic
1056628375 9:88272912-88272934 CAGTCTCTGTGTGGCCTGCATGG + Intergenic
1057208116 9:93185129-93185151 CCGGCGCTGCAGGGGCTGCGGGG - Exonic
1057481262 9:95447291-95447313 GCGTCTCTGCGCGGTCTGTAGGG + Exonic
1060984862 9:127814091-127814113 CCGTCTCTGCTGAGGGAGCAGGG - Intronic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1062195709 9:135272771-135272793 GCGTCTCTGCAGAGGCTGCTGGG - Intergenic
1062213940 9:135378949-135378971 CCGCCTCTGGGAGGGCTGCCGGG - Intergenic
1062324311 9:136004980-136005002 CGGTTTCTGTCGGGGCTGCAAGG + Intergenic
1062423347 9:136494626-136494648 CCGGCTCTACGGGGGCCGCGTGG - Exonic
1062686019 9:137813896-137813918 CCATCTCTCCGGGGGCTGGGAGG - Intronic
1185448155 X:269712-269734 CCGCCTGGGCGGGGCCTGCAGGG + Intergenic
1186623228 X:11263676-11263698 CAGTCTCTGCCTGGGCTGCTGGG - Intronic
1191253490 X:58270135-58270157 GCCTCTGTGCGGGGCCTGCAGGG - Intergenic