ID: 1082838130

View in Genome Browser
Species Human (GRCh38)
Location 11:57666850-57666872
Sequence AGAACATGGGGCATTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082838125_1082838130 -4 Left 1082838125 11:57666831-57666853 CCTCGAGCCGAATGGGGAGAGAA No data
Right 1082838130 11:57666850-57666872 AGAACATGGGGCATTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082838130 Original CRISPR AGAACATGGGGCATTGCTAT TGG Intergenic
No off target data available for this crispr