ID: 1082839037

View in Genome Browser
Species Human (GRCh38)
Location 11:57673482-57673504
Sequence TAAGCTAGGAAGGAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082839031_1082839037 -6 Left 1082839031 11:57673465-57673487 CCATCATTAGATGATCCTAAGCT 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1082839037 11:57673482-57673504 TAAGCTAGGAAGGAAGTGGGAGG 0: 1
1: 0
2: 3
3: 29
4: 355
1082839029_1082839037 1 Left 1082839029 11:57673458-57673480 CCCAGCTCCATCATTAGATGATC 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1082839037 11:57673482-57673504 TAAGCTAGGAAGGAAGTGGGAGG 0: 1
1: 0
2: 3
3: 29
4: 355
1082839030_1082839037 0 Left 1082839030 11:57673459-57673481 CCAGCTCCATCATTAGATGATCC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1082839037 11:57673482-57673504 TAAGCTAGGAAGGAAGTGGGAGG 0: 1
1: 0
2: 3
3: 29
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082839037 Original CRISPR TAAGCTAGGAAGGAAGTGGG AGG Intronic
901681666 1:10916397-10916419 AGAGCCAGGGAGGAAGTGGGCGG + Intergenic
901762480 1:11479827-11479849 TACGCTAGGTAGGGAGTGGGTGG - Intronic
904938172 1:34146506-34146528 GAAGCTAGGACAGATGTGGGAGG + Intronic
906731591 1:48086273-48086295 TAAGTTAGGAGAGAAGTAGGGGG - Intergenic
907845308 1:58200359-58200381 TAAGCGAGGAGGTGAGTGGGTGG - Intronic
908101625 1:60796957-60796979 TGAGCTAGGAAGGCAGCTGGGGG + Intergenic
909476433 1:76086157-76086179 TTAGCCAGCAAAGAAGTGGGGGG - Intronic
909644678 1:77903922-77903944 CAAGAAAGAAAGGAAGTGGGAGG + Intronic
910023104 1:82616911-82616933 TGAGATAGGAAGGAACTAGGAGG - Intergenic
910674414 1:89802219-89802241 CAGGCTAGGAAAGAAGTGGAGGG + Intronic
912113160 1:106369011-106369033 TAAGATGGTAAGAAAGTGGGAGG - Intergenic
912631804 1:111252824-111252846 TAAATTAGGAAGAAAGAGGGTGG - Intergenic
913695426 1:121320205-121320227 TAAGGTAGAGAGAAAGTGGGAGG - Intronic
914142139 1:144959855-144959877 TAAGGTAGAGAGAAAGTGGGAGG + Intronic
914958211 1:152183750-152183772 TAAGCTATGAAGGAAGTGAGTGG + Intergenic
916208703 1:162340662-162340684 GAGGATAGGAAGGAAATGGGAGG + Intronic
916472774 1:165140301-165140323 TGAGAAAGGAAAGAAGTGGGAGG - Intergenic
916881652 1:169024664-169024686 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
917764976 1:178205828-178205850 TAGGCTAAGAAGTAAGTGGTTGG - Intronic
917826185 1:178823660-178823682 TAAGCTAGGAAGGTACCCGGTGG + Intronic
918335006 1:183500724-183500746 CAAACAAGGAGGGAAGTGGGAGG + Intronic
920273972 1:204790159-204790181 AATTTTAGGAAGGAAGTGGGAGG - Intergenic
920482755 1:206338584-206338606 TAAGGTAGAGAGAAAGTGGGAGG - Intronic
921179633 1:212621790-212621812 TTAGAGAGGAAGGAAGTTGGGGG + Intergenic
923356673 1:233163112-233163134 TAATATAGGAAAGAAATGGGTGG - Intronic
923567005 1:235083789-235083811 TCAGTTAGGAAGGAGGTGGGTGG + Intergenic
923730560 1:236545804-236545826 AAAGCTGGGAAGGATGTGGAAGG + Intronic
923830430 1:237549690-237549712 TAAGATAAGCAGGAATTGGGAGG - Intronic
1063524726 10:6774207-6774229 AAAGCTAAGAAGAATGTGGGAGG - Intergenic
1069826538 10:71258290-71258312 TATCCTAGGAGGGGAGTGGGGGG - Intronic
1071002827 10:80850129-80850151 GAAGCTGGGAAGGGAGTGGGGGG + Intergenic
1071073971 10:81729573-81729595 GAAGGAAGGAAGGAAGGGGGGGG + Intergenic
1071492669 10:86146640-86146662 TGAGGAAGGAAGGAAGAGGGCGG - Intronic
1071837779 10:89436568-89436590 TGAGTTAGGCAGGCAGTGGGTGG - Intronic
1072156293 10:92726862-92726884 AAAGCTAACAAGGGAGTGGGTGG - Intergenic
1072545545 10:96434148-96434170 GAAGCTAGGAAGGAAATGTCAGG - Intronic
1072911764 10:99508309-99508331 GAAGGAAGGAAGAAAGTGGGAGG + Intergenic
1074049261 10:109867489-109867511 AAAGCTAAGCAGGAAGTGGATGG + Intronic
1074942430 10:118248426-118248448 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1075231483 10:120683612-120683634 TAAACTAAGAAGGAAATGGAAGG - Intergenic
1076109148 10:127848203-127848225 GGAGGGAGGAAGGAAGTGGGGGG + Intergenic
1076109183 10:127848295-127848317 GGAGGGAGGAAGGAAGTGGGGGG + Intergenic
1076739827 10:132477687-132477709 TCTGCTGGGAGGGAAGTGGGTGG - Intergenic
1078498474 11:11843544-11843566 TATGCAAGGAAGGAAGTGATAGG + Intronic
1080728803 11:34925360-34925382 TAAGCCAGGGAGGATTTGGGTGG - Intronic
1081538341 11:44012007-44012029 GATGCTAGGAGGGATGTGGGAGG + Intergenic
1081998289 11:47378210-47378232 CAAGCCAGGAGGGCAGTGGGTGG + Intronic
1082186232 11:49185306-49185328 TACGCTAAGTAGTAAGTGGGGGG - Intronic
1082839037 11:57673482-57673504 TAAGCTAGGAAGGAAGTGGGAGG + Intronic
1082962129 11:58928420-58928442 CAAGCTATGAAGGAAGTGTAAGG - Intronic
1084468509 11:69341484-69341506 CAAGGTAGGAAGGAAGAGGAAGG - Intronic
1084785060 11:71437402-71437424 TGAGCTGGGAGGGGAGTGGGGGG + Intronic
1085554737 11:77410267-77410289 TAAGCAAGATGGGAAGTGGGGGG - Intronic
1087955716 11:104285378-104285400 TAATCTTAGAAAGAAGTGGGGGG - Intergenic
1088299420 11:108340289-108340311 TAATATTGGAAGGAAGTTGGTGG - Intronic
1088391886 11:109323782-109323804 GAAGGAAGGAAGGAAGGGGGAGG - Intergenic
1088673139 11:112163827-112163849 TAAGCTAGAAAGCAATTGAGAGG - Intronic
1089283306 11:117389729-117389751 GAACCTAGGAAGGAAGAGTGTGG + Intronic
1089689448 11:120178101-120178123 GAAGGAAGGAAGGAAGAGGGAGG + Intronic
1089690869 11:120186055-120186077 CCAGCTTGGAAAGAAGTGGGGGG + Intergenic
1090270845 11:125385190-125385212 CAACCTAGGAAGGAAATGTGGGG - Intronic
1090746662 11:129710826-129710848 TAAGGAAGGAGGGAAATGGGAGG - Intergenic
1092092221 12:5812455-5812477 GAAGAAAGGAAGGAAGGGGGAGG + Intronic
1092095488 12:5838677-5838699 GAAGCATGGAAGGAAGTGAGAGG - Intronic
1095459441 12:42426894-42426916 TGAGCTGGGAAGGAAGTGGAGGG + Intronic
1096228265 12:49882971-49882993 TAGGGTAGGGAGGAAGAGGGAGG + Intronic
1097604197 12:61732277-61732299 TAAGCAAGGAAGAAAGTAGTAGG + Intronic
1097707314 12:62881428-62881450 GAAGACAGGAAGGAAGGGGGAGG + Intronic
1098146052 12:67498967-67498989 TGAGGTAGGTAGGAAGTAGGTGG + Intergenic
1099139896 12:78959767-78959789 TAAGCCAGGGAGGAACTCGGTGG + Intronic
1099169719 12:79349122-79349144 GAAGGTAGGAAGGAAGAGGAAGG + Intronic
1100199064 12:92279164-92279186 TAAGCTATGGGGGCAGTGGGGGG - Intergenic
1100269425 12:93010331-93010353 TAACCTAGTAAAGAAGTGGTAGG + Intergenic
1100565250 12:95789532-95789554 AAAGCCAGGATGGGAGTGGGAGG + Intronic
1100912642 12:99382963-99382985 AAAGCTAGAAGGGAAGTGGGTGG - Intronic
1101348561 12:103907202-103907224 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1102429936 12:112875337-112875359 GAAGCTGGGCAGGGAGTGGGAGG + Intronic
1102500964 12:113352258-113352280 GAAGGAAGGAAGGAAGGGGGGGG - Intronic
1103635697 12:122303403-122303425 TAAGGTAGGAAGGGTGTTGGGGG - Intronic
1104082140 12:125438665-125438687 TAAGGAAGGAAGGAAGAAGGAGG - Intronic
1104092056 12:125525735-125525757 AAAGCTGGGAAGGAAGCAGGAGG - Intronic
1105238284 13:18582846-18582868 AAAGGAAGGAAGGAAGGGGGAGG - Intergenic
1106001873 13:25731249-25731271 GAAGGAAGGAAGGAAGCGGGAGG + Intronic
1106652407 13:31705875-31705897 TGAGGTAGGGAGGAAGTGGTGGG - Intergenic
1108812108 13:54240118-54240140 TAAACTAGGAAGAATGAGGGGGG - Intergenic
1108928892 13:55789781-55789803 AAAGAAAGGAAGGAAGAGGGAGG - Intergenic
1109594529 13:64532832-64532854 TCAGATATGAAGGATGTGGGGGG - Intergenic
1113391390 13:109900695-109900717 TAAGTTAGGAAGGAGCTTGGAGG + Intergenic
1114486592 14:23066421-23066443 TTAGCAAGGAAGGACCTGGGAGG - Intronic
1114660114 14:24338572-24338594 AAAGGAAGGAAAGAAGTGGGAGG + Intronic
1115428213 14:33285873-33285895 TTACCTAGGAGGAAAGTGGGAGG - Intronic
1115933652 14:38527238-38527260 GAAGGAAGGAAGGAAGAGGGTGG + Intergenic
1116292301 14:43059551-43059573 TTAGCTGGTATGGAAGTGGGAGG - Intergenic
1117270990 14:54143305-54143327 TAGACTAGGAAGGGAGTGAGTGG - Intergenic
1117414783 14:55484736-55484758 TAGGCAAGGAGGGGAGTGGGTGG - Intergenic
1118635140 14:67741938-67741960 TCAGCAAGGAAGAAAGTTGGAGG - Intronic
1118654722 14:67934327-67934349 AAAGAGAGGAAAGAAGTGGGAGG + Intronic
1119187845 14:72656293-72656315 TAAACTAGGAATGATGTGGAAGG - Intronic
1119514114 14:75234559-75234581 GGAGATAGGAAGGAAGGGGGTGG - Intergenic
1119671043 14:76518524-76518546 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120460131 14:84784579-84784601 TAGTCTAGGAAGGAAAAGGGCGG + Intergenic
1120522313 14:85538460-85538482 TAACCTGGGAACAAAGTGGGGGG - Intronic
1121600421 14:95199193-95199215 TTAGCTAGGCCAGAAGTGGGGGG - Intronic
1121850283 14:97215585-97215607 GAAGCAAGGAAGGAAGGGGAGGG + Intergenic
1125293352 15:38174289-38174311 AAAACTAGGAAGAAAGAGGGAGG - Intergenic
1125632877 15:41162361-41162383 GAATCTAGGAGGGAAGCGGGAGG - Intergenic
1125714199 15:41810034-41810056 TGAATAAGGAAGGAAGTGGGAGG - Intronic
1126793689 15:52243239-52243261 GAAGATGGGAAGGAGGTGGGAGG + Intronic
1127516630 15:59700663-59700685 GCAGATAGGAATGAAGTGGGAGG - Intergenic
1128490804 15:68141330-68141352 TAAGAAAGGAAGGAAGGGAGGGG - Intronic
1129182607 15:73886687-73886709 CAAGCCAGGAAGAAAGGGGGAGG - Intronic
1131892014 15:96983348-96983370 TCAGCTGGGAATGCAGTGGGAGG + Intergenic
1132435933 15:101802777-101802799 GAAGGAAGGAAGGAAGTGGGGGG - Intergenic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1135939532 16:26809479-26809501 GAAGGAAGGAAGGAAGAGGGAGG + Intergenic
1137466404 16:48713846-48713868 GAAGGAAGGAAGGAAGAGGGAGG - Intergenic
1138313341 16:56047034-56047056 GAGGCCAGGAAGGCAGTGGGAGG + Intergenic
1138329611 16:56203129-56203151 TAAGCTGGGAGGGAACTGGGTGG + Intronic
1139240285 16:65384600-65384622 AAATCTAGGAAGGAAGTAGCTGG + Intergenic
1139427705 16:66893427-66893449 GGAGCAAGGCAGGAAGTGGGAGG + Intronic
1139439535 16:66958966-66958988 GAAGGAAGGAAGGAAGTGGGGGG + Intergenic
1139507079 16:67404167-67404189 TAAGTTAGGAAGGAAGCGGGAGG + Intronic
1139804670 16:69554531-69554553 TCAGTTTGCAAGGAAGTGGGGGG - Intergenic
1141076761 16:81013404-81013426 GAAGAGTGGAAGGAAGTGGGCGG + Intronic
1141112461 16:81281460-81281482 AAAAATAGGAAGGCAGTGGGTGG + Intronic
1141820176 16:86440340-86440362 TCAGCAAGGCAGTAAGTGGGGGG - Intergenic
1143354802 17:6318640-6318662 GAAGCTAGGAAGCAGGTGGATGG + Intergenic
1144770248 17:17755648-17755670 TAAGCAGGGAAGGATCTGGGGGG - Intronic
1147040477 17:37714500-37714522 TGAGCTAGGAAGTAAGTAGAAGG - Intronic
1148324116 17:46773420-46773442 AAAGCCAGGAAGGAAGTCTGTGG + Intronic
1148329641 17:46806120-46806142 GGAGCTCGGAAGCAAGTGGGCGG - Intronic
1148449379 17:47765723-47765745 TGAGCCTGGAAGGCAGTGGGAGG - Intergenic
1149657103 17:58316004-58316026 GAAGGTAGGAATGTAGTGGGGGG - Exonic
1149975143 17:61257929-61257951 TGATCTAAGAAAGAAGTGGGAGG - Intronic
1151100278 17:71548850-71548872 GAAGAGAGGAAAGAAGTGGGGGG - Intergenic
1152024986 17:77803023-77803045 GGAGCGAGGGAGGAAGTGGGAGG - Intergenic
1153375572 18:4373387-4373409 CAAGCAAGTGAGGAAGTGGGAGG + Intronic
1154511674 18:15110687-15110709 AAAGAAAGGAAGGAAGGGGGAGG - Intergenic
1154951660 18:21216217-21216239 TAAGATAGAAAGGATGTGGATGG + Intergenic
1155680851 18:28483694-28483716 TGAGCAGGGAAAGAAGTGGGAGG + Intergenic
1155766635 18:29642688-29642710 TACCCTAGGAAGCAAGTGAGAGG - Intergenic
1156173995 18:34520769-34520791 TTACCTAGGAAGGAAATGGCAGG - Intronic
1156576562 18:38323818-38323840 GAAGGTAGGAAGGAAGGCGGGGG + Intergenic
1158521664 18:58176289-58176311 GAAGCAAGGAAGGAAGGAGGAGG - Intronic
1162096381 19:8312255-8312277 TAAGCAAGAAAGGAAGCAGGAGG + Intronic
1164473790 19:28556807-28556829 TAAGCAGGGAAGGCTGTGGGGGG - Intergenic
1164762000 19:30735205-30735227 CACTCTAGGAAGGAAGTGGGAGG + Intergenic
1164840200 19:31387510-31387532 TAAGGGAGGAAGGCAGAGGGAGG - Intergenic
1165057402 19:33186591-33186613 CAAGAGAGGAAGGAAGTGGGAGG + Intronic
1165489903 19:36117048-36117070 TAAGACAGGAAGGAAGGGTGAGG - Intronic
1165749565 19:38251889-38251911 AAAGCAGGGAAGGAAGTGGGAGG + Intronic
1168230263 19:55026942-55026964 AGAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230283 19:55026996-55027018 GTAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230303 19:55027050-55027072 GTAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230323 19:55027104-55027126 GTAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230343 19:55027158-55027180 GTAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230363 19:55027212-55027234 GTAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230383 19:55027266-55027288 AGAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230418 19:55027374-55027396 GTAGGTGGGAAGGAAGTGGGAGG - Intronic
1168230438 19:55027428-55027450 GTAGGTGGGAAGGAAGTGGGAGG - Intronic
1168327636 19:55546335-55546357 TAAGTTTGGAAGGGAGAGGGAGG - Intergenic
925186502 2:1850177-1850199 GAAGGAAGGAAGGAAGGGGGAGG - Intronic
925507711 2:4586794-4586816 AAAGGAAGGAAGGAAGAGGGAGG - Intergenic
926290399 2:11524761-11524783 TCTGCTAGCCAGGAAGTGGGGGG - Intergenic
926649908 2:15331979-15332001 TAAGCCATGAAGGAAGAGGCAGG + Intronic
926651741 2:15353869-15353891 TAAGCTAGGAAAGATTAGGGTGG + Intronic
926997697 2:18754586-18754608 GAAGCTAGAAAGGATGAGGGCGG - Intergenic
927557423 2:24045642-24045664 GAAGGAAGGAAGGAAGGGGGAGG + Intronic
927914319 2:26925142-26925164 GGAGCTAGGATGGTAGTGGGAGG - Intronic
928620068 2:33079752-33079774 GAAGCCAGAAAGGAGGTGGGAGG - Intronic
929137368 2:38637653-38637675 GAAGGAAGGAAGGAAGAGGGAGG + Intergenic
929190589 2:39135896-39135918 GAAGCGTGGGAGGAAGTGGGAGG + Intergenic
929898954 2:45985019-45985041 TAGGCCATGAAGGAAGTGAGAGG + Intronic
932586730 2:73034903-73034925 AAAGCTGGGAAGGAAGTTGGAGG - Intronic
933969688 2:87460345-87460367 GAAGAGAGGAAGGAAGTGGAGGG + Intergenic
933998990 2:87690872-87690894 GGGGCTAGGAAGGAAGTGGATGG - Intergenic
935570760 2:104658647-104658669 GAAGGCAGGAAGGAAGCGGGCGG - Intergenic
935788632 2:106571049-106571071 AAAGATAGGAAGGAAGGGAGGGG - Intergenic
936078681 2:109417929-109417951 TAAGCTAAGAAGGTGGTGTGAGG + Intronic
936294854 2:111260011-111260033 GGGGCTAGGAAGGAAGTGGATGG + Intergenic
936324095 2:111490152-111490174 GAAGAGAGGAAGGAAGTGGGGGG - Intergenic
937630731 2:124098317-124098339 TAGGCTTAGAAGGAAGAGGGGGG + Intronic
937875227 2:126820031-126820053 TGATCTAGGAAGGAAGCTGGAGG - Intergenic
938511246 2:131947405-131947427 AAAGAAAGGAAGGAAGGGGGAGG - Intergenic
940767759 2:157808378-157808400 TAGCCTAGCAAGGAAATGGGGGG + Intronic
940830119 2:158457208-158457230 TAAGCTGGAAAGTAAGTGTGTGG + Exonic
941095789 2:161238513-161238535 TAAACTAGGAAGGAAAGCGGGGG + Intergenic
941150511 2:161908660-161908682 AAAACTAACAAGGAAGTGGGTGG + Intronic
941526192 2:166609788-166609810 CAAGCTACAAAGGAAGTGTGAGG + Intergenic
941633971 2:167915337-167915359 TAAGCTAGGAAGGATAAGGGAGG - Intergenic
943733246 2:191325653-191325675 AAACCTAGGAAGGAAATGGCAGG + Intronic
944295102 2:198052858-198052880 CAGGCTAGGAATGAAGGGGGAGG - Intronic
946109332 2:217400388-217400410 TAAGAAAGGGAGGAAGTGTGTGG + Intronic
946318151 2:218931611-218931633 TCATCTGGGAAGGAGGTGGGGGG + Intergenic
946686721 2:222278469-222278491 TAGACTAGGAAGGAACTGTGGGG - Intronic
946830561 2:223724186-223724208 TAAGATAGGCAGGATGGGGGTGG - Intergenic
948406302 2:237722596-237722618 TAAGATGGGGAGGAAGTGGATGG + Intronic
1168989076 20:2078968-2078990 TAAACTAGGAAGAAATGGGGTGG + Intergenic
1169066311 20:2696001-2696023 CAAGCCAGGGAGGAAGCGGGTGG - Intronic
1169505765 20:6209404-6209426 AAAGGAAGGAAGGAAGAGGGAGG - Intergenic
1170355765 20:15490198-15490220 GAAGGAAGGAAGGAAGGGGGAGG - Intronic
1170540278 20:17380754-17380776 TAAGGCAGGAAGGGAGGGGGAGG - Intronic
1170880969 20:20296241-20296263 GAAGAAAGGAAGGAAGAGGGAGG - Intronic
1171451263 20:25237616-25237638 TAAGGTAGGGAGGAAGATGGTGG + Intergenic
1171871389 20:30529019-30529041 TGAGCTAGAAGGGAAGAGGGAGG - Intergenic
1172350530 20:34235915-34235937 GAAGGAAGGAAGGAAGCGGGAGG + Intronic
1172988122 20:39009606-39009628 AAAGCTAGGCAGGAAGGGTGGGG - Intronic
1173186819 20:40846642-40846664 TAAGCCAGCAAGTGAGTGGGGGG - Intergenic
1173701389 20:45074999-45075021 TAAGCTAGAAGAGAAGTGGAAGG - Exonic
1174157872 20:48528434-48528456 AAAGCTGGGAAGGGAGGGGGTGG + Intergenic
1174221103 20:48956304-48956326 TATCCTAGGAAGGCTGTGGGGGG - Intronic
1175170768 20:57079896-57079918 TAAGCAGGGAAGGAAGGGGGAGG - Intergenic
1175479185 20:59299832-59299854 AAGGCTATGAAGGAAGTAGGGGG + Intergenic
1176142828 20:63552883-63552905 TAGGCCTGGCAGGAAGTGGGTGG - Intronic
1176782271 21:13211123-13211145 GAAGGAAGGAAGGAAGGGGGAGG - Intergenic
1176922040 21:14699373-14699395 TAGACTAGAAAGGAAGAGGGTGG - Intergenic
1177527667 21:22316539-22316561 AAAGCAAGGAAAGAAGTGAGTGG + Intergenic
1178167158 21:29992214-29992236 CAATGTAGAAAGGAAGTGGGTGG - Intergenic
1178791550 21:35704973-35704995 AAAGGAAGGAAGGAAGGGGGAGG + Intronic
1179956395 21:44741655-44741677 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1181114332 22:20621659-20621681 TGAGGTAGGAAGGTTGTGGGTGG - Intergenic
1182953813 22:34402244-34402266 GAAGCTAAGAAGGGGGTGGGTGG - Intergenic
1182972845 22:34593853-34593875 AAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1184585357 22:45444296-45444318 TTATCTAGGAAGAAAATGGGAGG + Intergenic
1185133615 22:49055853-49055875 GAAGGGAGGAAGGAAGAGGGAGG - Intergenic
949320911 3:2809432-2809454 TAAGTAAGGAGGGAAGTGGCAGG + Intronic
949921084 3:9001073-9001095 GAGGCTAGGAAGGAAGGGGAGGG + Intronic
950171242 3:10840314-10840336 AAAGTTAGCAAAGAAGTGGGGGG - Intronic
950829434 3:15859657-15859679 AAAGAAAGGAAGGAAGAGGGCGG - Exonic
952162434 3:30707184-30707206 TAAGAGAGGAAGCAAGTGAGAGG - Intergenic
952827439 3:37536135-37536157 TGAGCTTGGATGGAAGTGGAGGG - Intronic
953214006 3:40900940-40900962 GAGGCTGGGAAGGTAGTGGGTGG + Intergenic
953242231 3:41159838-41159860 GAAGATAAGAAGGAAGTGGAAGG + Intergenic
954091601 3:48288868-48288890 TGAGCCAGGCAGGAAGTAGGGGG + Intronic
954114449 3:48458016-48458038 TAAGCTTGGGAGGAGGGGGGAGG - Intronic
955149386 3:56352005-56352027 TAACCAAGGAAAGAAGTGGAAGG + Intronic
955238619 3:57161419-57161441 AAAGGTAGGAAGGAATAGGGTGG - Intronic
955330274 3:58041570-58041592 TAAGTTAGGAAGGAAAAGGTTGG - Intronic
957030022 3:75229424-75229446 TAAGGCAGGGAGGGAGTGGGCGG + Intergenic
957271219 3:78032648-78032670 TAAGCAGGGAGGGCAGTGGGGGG - Intergenic
959662414 3:108883520-108883542 GGAGGCAGGAAGGAAGTGGGTGG + Intergenic
959878711 3:111417673-111417695 GAAGGTAGCAAGGAGGTGGGGGG + Intronic
961534400 3:127560843-127560865 TAAGATATGAAGAAAGTGAGGGG - Intergenic
962517972 3:136171293-136171315 AAAGGAAGGAAGGAAGTGGCTGG + Intronic
963472550 3:145760246-145760268 TCAGCCAGGAAGGAAGAGGATGG + Intergenic
963667441 3:148206782-148206804 TAAGTTAGGAGGGAGGTGGTTGG - Intergenic
964336995 3:155665488-155665510 TAAACTAGCAAGGTAGTGGAAGG + Intronic
964345981 3:155755216-155755238 TTATCTAGTAAGTAAGTGGGTGG - Intergenic
964563961 3:158029399-158029421 GAAGCTGGGAAGGAAGAGGGAGG + Intergenic
964777966 3:160299994-160300016 TGAGCTAGGTAGAGAGTGGGAGG - Intronic
966509302 3:180743833-180743855 TAAGGAAGGAAGGAGGTGGAAGG + Intronic
967505040 3:190244264-190244286 TAAAATAGGAAGGAATTGAGAGG - Intergenic
968006633 3:195247568-195247590 AGAGCCAGGAAGGAGGTGGGGGG - Intronic
968229551 3:196997307-196997329 GAAGCTAGGAAGGAGGAAGGGGG + Intronic
968771024 4:2507189-2507211 GAAGGAAGGAAGGAAGAGGGAGG + Intronic
969083247 4:4636509-4636531 AGAGCTAGGAATGAAGTGAGAGG + Intergenic
969586164 4:8095022-8095044 GAAGGAAGGAAAGAAGTGGGGGG - Intronic
969726040 4:8918758-8918780 GAAGGAAGGAAGGAACTGGGGGG - Intergenic
970506170 4:16732885-16732907 GTAGCTAGGTAGGAAGTGGGTGG - Intronic
970850354 4:20595385-20595407 AAAGAAAGGAAGGAAGAGGGAGG + Intronic
971252994 4:24988828-24988850 TCAGCTAGGAAGGACCTTGGAGG + Intergenic
971271484 4:25151008-25151030 AACGCTAGCAAGGAAGGGGGAGG + Intronic
971779253 4:31009978-31010000 TATGCTAGAAAGGAAGAGGGAGG + Intronic
971994050 4:33941048-33941070 TAAGTGAGGAAGGCAGTGGGAGG + Intergenic
972725253 4:41741826-41741848 GAAGCTGGGATGGAGGTGGGGGG + Intergenic
973871740 4:55173269-55173291 TAAGCTGGGGAGGAAGTGGCAGG + Intergenic
974227416 4:59064880-59064902 TAAGATATGAAGTAAGTGGAAGG + Intergenic
975692302 4:76977902-76977924 GAAGCTAAGGAGGAAGTGGTGGG + Intronic
975960391 4:79897123-79897145 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
976518570 4:86000460-86000482 TAAGCTACAAAGGATGTTGGGGG - Exonic
976615266 4:87069617-87069639 AAAGGAAGGGAGGAAGTGGGGGG - Intronic
978640712 4:110867950-110867972 GAAGATAGGAAGGCAGTGGAAGG - Intergenic
979399420 4:120230066-120230088 GAAGCTAGGAGGGAAGAGTGAGG + Intergenic
979740799 4:124148260-124148282 GAAGGAAGGAAGGAAGAGGGAGG - Intergenic
981365888 4:143902653-143902675 TAAGCAAGGAAGGAGGTGAAGGG - Intronic
981375994 4:144016467-144016489 TAAGCAAGGAAGGAGGTGAAGGG - Intronic
981386520 4:144137826-144137848 TAAGCAAGGAAGGAGGTGAAGGG - Intronic
982287696 4:153752451-153752473 GATGCCAGGAAAGAAGTGGGTGG - Intronic
982497664 4:156110815-156110837 TAACTAAGGCAGGAAGTGGGAGG + Intergenic
982607414 4:157532581-157532603 TAAGTAAGGAAAGAAGTGGCCGG + Intergenic
983379682 4:166976168-166976190 TAAGATGGGAAGAAAGTGGTAGG - Intronic
984053965 4:174903199-174903221 GAAGCTAGTAAGGATGTGGAAGG - Intronic
984708271 4:182863633-182863655 TGAGCAAAGAAGGAGGTGGGTGG - Intergenic
984759134 4:183348714-183348736 TCAGCAAGGTAGGGAGTGGGAGG - Intergenic
984907999 4:184648388-184648410 TAAGCAGGAAAAGAAGTGGGTGG + Intronic
985003389 4:185507873-185507895 AAAATTAGGAAGGAGGTGGGAGG - Intronic
988398062 5:30722176-30722198 TTAGATAGGAAGAAAGTGGTGGG + Intergenic
990054026 5:51547482-51547504 AAAGATATGAAGGAAGTGAGGGG + Intergenic
990448827 5:55917212-55917234 TAACCTAGGCAGGATGTGGCAGG - Exonic
990835998 5:60020913-60020935 TTAGCTCTGAAGGAAGTGGAAGG + Intronic
992395553 5:76366297-76366319 GAAGGAAGGAAGGAAGGGGGAGG - Intergenic
992532628 5:77666861-77666883 GATGCTAGGTAGGAAGTGGTGGG + Intergenic
992758348 5:79930219-79930241 TGAGCTAGGAAGTCTGTGGGAGG + Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
994048434 5:95335219-95335241 GAAGGAAGGAAGGAAGGGGGAGG - Intergenic
996329242 5:122311658-122311680 GAAGCAAGGAAGGGGGTGGGGGG + Intronic
997394278 5:133545438-133545460 TAATATAGTAGGGAAGTGGGTGG - Intronic
998066660 5:139164727-139164749 AAAGCTAGTAAGGAAGAGGTGGG + Intronic
999949041 5:156628763-156628785 TTTGGTAGGGAGGAAGTGGGAGG + Intronic
1000018346 5:157298097-157298119 AAAGCAGGGAAGGAAGGGGGAGG - Intronic
1000772002 5:165366198-165366220 GAAGAAAGGAAGGAAGTGGGAGG + Intergenic
1001774778 5:174320704-174320726 GAAGGAAGGAAGGAAGGGGGAGG - Intergenic
1004109712 6:12705076-12705098 GAAGGAAGGAAGGAAGAGGGAGG + Intergenic
1004343491 6:14827827-14827849 TAAGCCAGGGAGGTTGTGGGAGG + Intergenic
1004822902 6:19387475-19387497 TAAGAAAGAAAGGAAGGGGGAGG - Intergenic
1005089529 6:22042277-22042299 GAAGCAAGGAAGGAAGAAGGAGG - Intergenic
1005392343 6:25346248-25346270 GAAACAAGGAAGCAAGTGGGCGG - Intronic
1006755351 6:36410455-36410477 GAAGGAAGGAAGGAAATGGGAGG + Intronic
1007806930 6:44457482-44457504 TTTGGTAGGAAGGAAATGGGTGG - Intergenic
1008386901 6:50902339-50902361 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1008534737 6:52499240-52499262 TAAGCTCGGAAGGCAGAGTGAGG + Exonic
1008593631 6:53018807-53018829 TAAGAGAGAAAGGAAGAGGGAGG + Intronic
1008623113 6:53291364-53291386 TAGGGGAGGAAGGAAGTGGGTGG - Intronic
1009244585 6:61220590-61220612 TAACCAATGAAGTAAGTGGGAGG + Intergenic
1010284591 6:74060695-74060717 TAAACTTGGAAGGTATTGGGCGG - Intergenic
1010555308 6:77272385-77272407 TTAGCTAGAAAGTAAGTGGGTGG - Intergenic
1010656386 6:78516589-78516611 TAAAGTAAGAAGGAAGTGGGGGG - Intergenic
1011287417 6:85739845-85739867 CAAGGTCTGAAGGAAGTGGGAGG + Intergenic
1013087626 6:106869825-106869847 GAAGCTAGGTAGGAAGTGGTGGG + Intergenic
1013288408 6:108699564-108699586 GGAGCCAGGAAGCAAGTGGGAGG - Intergenic
1013403747 6:109823920-109823942 TAAGCTAACAAGGCAGTGTGAGG - Intronic
1015151028 6:130037931-130037953 GAGGCTAGGAAGGGGGTGGGAGG - Intronic
1015338100 6:132064905-132064927 TAAGCCAGGGAGGAAGATGGTGG + Intergenic
1015453322 6:133396028-133396050 TAAGATAGGAAAGAAGGGGAAGG - Intronic
1016096535 6:140044692-140044714 AAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1016876818 6:148873599-148873621 TAAGCAAGGCAGGGAGTGTGTGG + Intronic
1020354779 7:7264386-7264408 TTAGGAAGGAGGGAAGTGGGTGG + Intergenic
1021173663 7:17424954-17424976 TGAGCTAGGCAGGAAGGAGGAGG - Intergenic
1021746970 7:23751026-23751048 GAGGCTAGGAAGGATGTGGTAGG - Intronic
1021773710 7:24030749-24030771 CAAGTACGGAAGGAAGTGGGAGG - Intergenic
1022438447 7:30412241-30412263 ACAGCAAGGAAGGACGTGGGTGG - Intronic
1022502854 7:30893437-30893459 CAGGCTGGGAGGGAAGTGGGAGG + Intergenic
1022559451 7:31334058-31334080 CAGGCGAGGAAGGAATTGGGTGG + Intergenic
1022597958 7:31730801-31730823 TCTGCTTGGAAGGAAGTGAGTGG + Intergenic
1023165760 7:37342361-37342383 GAAGCTAGGAAGGAGGTGGGAGG - Intronic
1026063915 7:67052250-67052272 TCTTCTAGGAAGCAAGTGGGTGG - Intronic
1026065501 7:67068493-67068515 CATGCTAGGAAAGAAGGGGGAGG + Intronic
1026174015 7:67980005-67980027 TAAGGTAGGAAGGAAGGGAAGGG - Intergenic
1026714439 7:72775210-72775232 TCTTCTAGGAAGCAAGTGGGTGG + Intronic
1028858559 7:95620781-95620803 TAAGCGGGGAAGGGAATGGGAGG - Intergenic
1028891619 7:95994403-95994425 CAGGCAAGGAAGGAAGTGGTTGG + Intronic
1029361047 7:100088942-100088964 GAAGCCGGGAAGGAAGGGGGCGG + Exonic
1030153157 7:106426338-106426360 TGAGCTAGAAGGGAAGAGGGAGG - Intergenic
1032119885 7:129148160-129148182 CCAGCGAGGAAGGAGGTGGGCGG - Intronic
1032846709 7:135757513-135757535 TAAGATAGATAGGAAATGGGAGG - Intergenic
1034168268 7:149042621-149042643 AAAGAAAGGAAGGAAGGGGGGGG + Intergenic
1034412721 7:150949727-150949749 CAGGGTAGAAAGGAAGTGGGGGG + Intronic
1038220186 8:25599851-25599873 TAAGGGAGGCAGGAAGTGGGTGG - Intergenic
1038276838 8:26128245-26128267 GAAGGAAGGAAGGAAGGGGGAGG + Intergenic
1038388924 8:27176426-27176448 GAAGAAAAGAAGGAAGTGGGAGG - Intergenic
1038957747 8:32485586-32485608 GAAGGAAGGAAGGAAGTAGGTGG + Intronic
1038961556 8:32525726-32525748 GAAGCTAGGAGGAAAGGGGGCGG - Intronic
1039213231 8:35238923-35238945 TAAAGTGGGAAGGAAGAGGGTGG - Intronic
1039396642 8:37231551-37231573 GAAGGGAGGAAGGAGGTGGGGGG + Intergenic
1039863403 8:41479267-41479289 GAAGCAAGACAGGAAGTGGGAGG - Intergenic
1042450557 8:68940461-68940483 TGAGGTCTGAAGGAAGTGGGTGG + Intergenic
1045297113 8:100881781-100881803 TGAGGTCTGAAGGAAGTGGGTGG + Intergenic
1045755155 8:105533834-105533856 GAAGGAAGGAAGGAAGAGGGAGG - Intronic
1046026267 8:108727863-108727885 TAAGATAGGAAGTAAGTCAGGGG + Intronic
1046155853 8:110289353-110289375 AATGAGAGGAAGGAAGTGGGGGG - Intergenic
1046259973 8:111755090-111755112 TTATCTAGGAAGGAAATGAGAGG - Intergenic
1047203861 8:122787865-122787887 TAAGTTAAGGAGGAAGTGGCAGG + Intronic
1047658620 8:127007159-127007181 TAAGCTATGAAGAAAATGGTGGG - Intergenic
1047767709 8:128002962-128002984 GAAGGAAGGAAGGAAGAGGGAGG - Intergenic
1047903563 8:129449402-129449424 GAAGGAAGGAAGGGAGTGGGGGG + Intergenic
1048336092 8:133503531-133503553 TAAGGCAGCCAGGAAGTGGGGGG - Intronic
1051057521 9:13005165-13005187 CAAGAGAGGAAGGAAGTGTGTGG + Intergenic
1051160832 9:14205240-14205262 GAAGGGAGGAAGGAAGGGGGAGG + Intronic
1052312341 9:27081037-27081059 TAAGCTGGGAAGGCGATGGGAGG + Intergenic
1055028926 9:71752465-71752487 GAAGGAAGGAAGGAAGGGGGAGG + Intronic
1055856429 9:80693148-80693170 TAAGAAAGGAAGGAAGGAGGAGG - Intergenic
1056836188 9:89957518-89957540 TAGGCTAGCATGAAAGTGGGAGG + Intergenic
1058204645 9:102088073-102088095 TAAGGTAGGAAAGAAGAGAGGGG + Intergenic
1060480786 9:124015809-124015831 TTTGCTAGGCAGGAAGTGGCAGG + Intronic
1062077601 9:134600250-134600272 TGAGGCAGGAAGGAAGAGGGAGG + Intergenic
1062707425 9:137953223-137953245 TGTGCTAGGAAGGAGGTGGAAGG + Intronic
1185999257 X:4989557-4989579 GAAGCAAGGAAGGAAGGAGGAGG - Intergenic
1186490038 X:9964274-9964296 GAAGGAAGGAAGGAAGGGGGAGG - Intergenic
1187270186 X:17773423-17773445 TTAGGAAGGAAGGAAGTGGTGGG - Intergenic
1191811690 X:65196242-65196264 CAAGCTGGGAAGGAAGTGTGAGG + Intergenic
1194820336 X:98498321-98498343 TTAGCTAGGTAAAAAGTGGGTGG - Intergenic
1195280186 X:103325559-103325581 TATGGTAGGAAAGAAGTGGGTGG - Intergenic
1195959549 X:110371534-110371556 GAGGCTGGGAAGGTAGTGGGGGG - Intronic
1197109007 X:122750007-122750029 GAAACTAGAAAGAAAGTGGGAGG + Intergenic
1198064039 X:133078109-133078131 CAAGCAAGGGAGGAAGTGGCTGG - Intronic
1198538788 X:137614128-137614150 TAACATAGGAAAAAAGTGGGGGG + Intergenic
1200171933 X:154083322-154083344 GAAGCCAGGAAGGAAGAGGGCGG + Intronic