ID: 1082839817

View in Genome Browser
Species Human (GRCh38)
Location 11:57679811-57679833
Sequence CACACATGCCTCTCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082839810_1082839817 23 Left 1082839810 11:57679765-57679787 CCTTAAATCAAGCAGAATTTGGG 0: 1
1: 0
2: 0
3: 18
4: 150
Right 1082839817 11:57679811-57679833 CACACATGCCTCTCCTTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 135
1082839808_1082839817 28 Left 1082839808 11:57679760-57679782 CCTCTCCTTAAATCAAGCAGAAT 0: 1
1: 0
2: 0
3: 27
4: 311
Right 1082839817 11:57679811-57679833 CACACATGCCTCTCCTTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082839817 Original CRISPR CACACATGCCTCTCCTTGGT GGG Intronic
901668345 1:10838941-10838963 CACGCATGCCTGCCCTTGCTTGG - Intergenic
901774259 1:11548772-11548794 CACTCCTGGCTCTCCTTGGCTGG + Intergenic
904287598 1:29462187-29462209 CACACAAGCCTGGCCGTGGTGGG - Intergenic
905335889 1:37244300-37244322 CACACTTTCCTTGCCTTGGTTGG - Intergenic
911462776 1:98211710-98211732 CACCCAGGCATCTCCTGGGTGGG - Intergenic
915565324 1:156709758-156709780 CACATCTGCCTCTCTTTGCTAGG - Intergenic
920243902 1:204573726-204573748 CTCACCTGTCTGTCCTTGGTTGG - Intergenic
923361084 1:233211698-233211720 CATGCATGCCTCCCCATGGTTGG - Intronic
1062768072 10:80483-80505 CACCCAGGCATCTCCTTGCTGGG + Intergenic
1063864250 10:10346783-10346805 CAAACATGCCTTTCCCTGTTAGG - Intergenic
1064003228 10:11680799-11680821 CACACATGCCTCTCAATGCCAGG + Intergenic
1069189957 10:65474740-65474762 CACACATGGCTCTTCTTCATGGG + Intergenic
1070373988 10:75811249-75811271 CACACTTTCCTCTCCTTCATGGG + Intronic
1070773872 10:79098806-79098828 CTCACAGGCCTGTCCTCGGTAGG - Intronic
1071224534 10:83513076-83513098 AACACATGCCTCTTAATGGTGGG + Intergenic
1071336519 10:84604904-84604926 CACAAATGGCTCTCCTTCTTGGG - Intergenic
1071532055 10:86397674-86397696 CTCACCTGCCTCACCCTGGTTGG - Intergenic
1075076727 10:119356996-119357018 CACACATGCTGTTCTTTGGTGGG - Intronic
1077412146 11:2408643-2408665 CACACCTGCTTCTCCCTTGTAGG + Intronic
1082769084 11:57191870-57191892 CACACATGCCCCTCCATGGCTGG - Intergenic
1082839817 11:57679811-57679833 CACACATGCCTCTCCTTGGTGGG + Intronic
1083625759 11:64071268-64071290 CACACAGGCCTGTGCTGGGTGGG - Intronic
1085228164 11:74941501-74941523 CATACATCCCTCTCCTTCTTGGG - Intronic
1085413635 11:76306325-76306347 CACACTGGCCTCTGCTTGGTAGG + Intergenic
1086161716 11:83729093-83729115 TACACATGTCTTTCCTGGGTGGG - Intronic
1086247797 11:84775451-84775473 CACACATGTGTCTTTTTGGTAGG - Intronic
1088141245 11:106619410-106619432 CACACAAGCCTCTTATTGCTTGG + Intergenic
1090849998 11:130563835-130563857 CACACATGCTTTTGCTTGGGAGG + Intergenic
1091156926 11:133382785-133382807 CTCAGAGGCCTCTCCTTTGTCGG - Intronic
1091785676 12:3242159-3242181 CACACAGGCTTCTCCCTGCTGGG - Intronic
1092942994 12:13427914-13427936 GACACATGCCTCTGCGTGGCTGG - Intergenic
1093658747 12:21728207-21728229 CACACGTGGGTCTTCTTGGTTGG + Intronic
1096665472 12:53161135-53161157 CACACAGGCATCTCCTGGATGGG - Exonic
1097882235 12:64696352-64696374 TGCACATGCATCTCTTTGGTTGG - Exonic
1098531157 12:71543264-71543286 CCCACATGCCTTTCCTGGGCTGG + Intronic
1100733623 12:97501631-97501653 GTCACCTGCCTCTCCTTGCTGGG + Intergenic
1102003284 12:109572149-109572171 CACTCCTGCCTCTTCTTGGATGG - Intronic
1103825188 12:123732300-123732322 CACACTTGCCTCGCCTGGCTGGG + Intronic
1104452153 12:128878727-128878749 CCCACATGCCTGTACTTGGGAGG - Intronic
1107313291 13:39103673-39103695 CACACTTTCCTCTCATTGCTAGG + Intergenic
1117316741 14:54578195-54578217 CCCACATGCCTCTCCACTGTAGG + Intronic
1119768773 14:77207182-77207204 CAGAGATGCCTCTCCTTGCCAGG - Intronic
1123934649 15:25188247-25188269 CACACATACCTCTCCAAGGTCGG - Intergenic
1126688152 15:51266231-51266253 GACACATTCCTCTCCTTGCAAGG + Intronic
1133887717 16:9846175-9846197 TACACTTGCCCTTCCTTGGTGGG + Intronic
1134693632 16:16207191-16207213 AACACATGCCCTTCCTTTGTGGG + Intronic
1134773333 16:16830064-16830086 CACCCATGGCTCTCCTGGGCTGG + Intergenic
1134978214 16:18587452-18587474 AACACATGCCCTTCCTTTGTGGG - Intergenic
1135674262 16:24402007-24402029 AACACATGCCACTCCCTGTTGGG + Intergenic
1137713958 16:50586358-50586380 CACAGAGGCGTCTCCTTGTTTGG + Intronic
1139345432 16:66300167-66300189 CACCCATGCCTCTTCTTGAGAGG + Intergenic
1143639668 17:8188959-8188981 CACACAGGCCTCCCCTCAGTGGG + Exonic
1143797211 17:9346830-9346852 AAGAAATGCCTCTCCTTGCTGGG + Intronic
1144826345 17:18107718-18107740 CACACAGGGCTCTCCATGATGGG + Exonic
1146374801 17:32286857-32286879 CACCCATGCCAGGCCTTGGTGGG - Intronic
1146688038 17:34854802-34854824 CACAAGTGTCTCTCCTTGTTTGG - Intergenic
1148190651 17:45676575-45676597 CACACCTGCTTCTCCAAGGTGGG + Intergenic
1148441532 17:47714037-47714059 CACACACCCCTCCCCTTGTTAGG - Intergenic
1148600977 17:48893924-48893946 TACAGATGGCTCTCCTTGGATGG + Intronic
1148766843 17:50044462-50044484 CACACATGCCTCACAGTGATGGG + Intergenic
1148785089 17:50142330-50142352 AACACATGCCACTCCCAGGTGGG + Intronic
1150145485 17:62765586-62765608 CCCACATGCCTCTCCTTCAGAGG - Intronic
1151476964 17:74349594-74349616 CTCACGTGCCTCTCCCTCGTGGG - Intronic
1152357606 17:79814393-79814415 CAAGCATGCCACTCCTTGATAGG + Intergenic
1152659292 17:81535006-81535028 CCCTCACGCCTCTCCTGGGTAGG - Intronic
1157197497 18:45631305-45631327 CACACAGGTCACTCCTTGGCAGG + Intronic
1159475461 18:68915262-68915284 CACACCTGCCTCACCTTGGCGGG - Intronic
1160229371 18:77034774-77034796 AGCCCCTGCCTCTCCTTGGTGGG + Intronic
1160754628 19:751043-751065 CACACCTGCCTCCCCTGGGTGGG + Intergenic
1161086291 19:2337110-2337132 CACAGATGCCTGGCCGTGGTGGG + Intronic
1164938329 19:32231878-32231900 CACACAGGCCTCTGCTCAGTTGG - Intergenic
1167666779 19:50826942-50826964 CACACAGGCCTCCCCCGGGTGGG + Exonic
1168206322 19:54852952-54852974 CACACCTGGCTATCCTTGTTTGG - Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
925050163 2:807260-807282 CACCTATGCCCCTCCTGGGTGGG + Intergenic
926043654 2:9693960-9693982 CACCCCTGCCTCTCCGTGGGCGG + Intergenic
929865369 2:45712833-45712855 CACACTTCCCTGTCCTTGGAGGG + Intronic
929882795 2:45851904-45851926 CCCACCTGCCTCTCCATGGCAGG - Intronic
937672306 2:124551096-124551118 CACACATGCCTCTCCCTGCACGG - Intronic
944535158 2:200701972-200701994 CACCCATGCCTCTCCTTGTTGGG - Intergenic
948546771 2:238738167-238738189 CACAGATTCCACTCCTAGGTAGG - Intergenic
1170354977 20:15482037-15482059 CACACATGCCTATCCAGGCTCGG + Intronic
1170511504 20:17082558-17082580 CACACACCCCACTCCTTGGGAGG + Intergenic
1171305186 20:24099083-24099105 CACACATGCATCCCCGTGGGAGG - Intergenic
1172816642 20:37692454-37692476 GGCACATGCCTCTACTTGGGAGG - Intergenic
1173522914 20:43712409-43712431 CTCCCTGGCCTCTCCTTGGTGGG + Intronic
1173844958 20:46182479-46182501 CAAACATCCCTCTTCTTGCTTGG - Intronic
1174361640 20:50032528-50032550 CACACATGATTGTCCTTTGTGGG + Intergenic
1175896689 20:62339054-62339076 CAAACACGCCTCTCCCTTGTTGG - Intronic
1175998492 20:62821749-62821771 CACTCCTGCCTCTCCCTGGAGGG - Exonic
1179201990 21:39233142-39233164 CACACAGGTCTCTCCTTAGCTGG - Intronic
1183207364 22:36428698-36428720 CACACACACCTCTGCTTGTTGGG - Intergenic
1185081839 22:48713811-48713833 CACAGATGCCTTTCCTGGGATGG - Intronic
1185372611 22:50468025-50468047 CACACAGGCAGCTCCTTGCTTGG + Intronic
1185392236 22:50568784-50568806 CACACATGCCCCTGCATGGGAGG + Intergenic
953523632 3:43667883-43667905 CACACATGTTTCTCCATGATTGG - Intronic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
957714945 3:83916102-83916124 CTCAGGTGCCTCTCCTTGGGAGG - Intergenic
957714970 3:83916206-83916228 CTCAGGTGCCTCTCCTTGGGAGG - Intergenic
957714976 3:83916232-83916254 CTCAGGTGCCTCTCCTTGGGAGG - Intergenic
957983042 3:87536777-87536799 CACACATGATTCTCCGTGGTGGG + Intergenic
962922469 3:139963486-139963508 CACACATGACCCACCTTGGAGGG + Intronic
967197395 3:187040406-187040428 CACAGATGCATGTCCTTGGGTGG + Intronic
968793809 4:2688515-2688537 CACACAGGCCTCCCCTTGGCCGG - Intronic
969966078 4:10997426-10997448 CACACATGCTTCTATTTGGAGGG - Intergenic
975031921 4:69631639-69631661 TACACACTCCTCTCCTTGCTTGG - Intronic
975601192 4:76101242-76101264 CACACCTTCCTCTATTTGGTGGG - Intronic
980461171 4:133116339-133116361 CTCAGATTCCTCTCCTTTGTGGG - Intergenic
984064134 4:175027226-175027248 CACACATGCTCCCCCTTGTTAGG + Intergenic
985033301 4:185813760-185813782 CACTCATGACTCTCCCAGGTGGG + Intronic
987034313 5:14005028-14005050 CACACGAGCCTCTTCATGGTGGG + Intergenic
992863664 5:80937134-80937156 CAACCATGCCTCTCATTGGCTGG - Intergenic
995598418 5:113771737-113771759 CACCCTAGCCTCTGCTTGGTTGG - Intergenic
998038786 5:138937777-138937799 CACCCATGCCTCTCCCAGGATGG + Intergenic
1000012326 5:157244441-157244463 GACACATGCCTCTTCCAGGTAGG - Exonic
1000276017 5:159735455-159735477 TTCACATGCTTCTCCTTGGCTGG - Intergenic
1001794447 5:174490398-174490420 CACACATGCTTTTTCTTGTTAGG - Intergenic
1002062525 5:176634314-176634336 CACAAATGGCTCTCCAAGGTTGG + Intronic
1002151787 5:177239535-177239557 CACACATCCCTCACATTAGTTGG + Intronic
1003516622 6:6823870-6823892 CACACCTGACACTCCTTGGCAGG + Intergenic
1004986783 6:21091711-21091733 CACACACGCCTTTCCTTGTTTGG + Intronic
1013433668 6:110080138-110080160 CACACATCCCTCTCTGTGCTGGG - Intergenic
1014698977 6:124659733-124659755 CACACATGCTTCTGCTTGGGAGG + Intronic
1015648563 6:135425581-135425603 CACAAATACCTCTCTTAGGTAGG + Intronic
1017773409 6:157661072-157661094 CACACATGCCTGTGCTTTGTTGG - Intronic
1021902964 7:25305952-25305974 TCCCCATGCCTCTCCTTGTTAGG - Intergenic
1022598949 7:31738596-31738618 CAGAAATGCCTCTCCTAGCTGGG - Intergenic
1031230804 7:119103401-119103423 CACTCATCCCTCTCCCTGTTGGG + Intergenic
1034486378 7:151366663-151366685 CACACATGCAGCCCCTTGATAGG - Intronic
1034925015 7:155114187-155114209 CACCCATCCCTCTCCTAAGTTGG - Intergenic
1038691243 8:29765392-29765414 CACATATACCTCTTCTTGGCAGG + Intergenic
1042818871 8:72908748-72908770 CACACATCCCTCTGCTTCCTTGG + Intronic
1042951230 8:74202469-74202491 CACACATGGTTCTATTTGGTAGG + Intergenic
1043443520 8:80297806-80297828 CACACAGGCTTCTCAGTGGTTGG + Intergenic
1046620272 8:116521800-116521822 CACACATGCTGAGCCTTGGTGGG - Intergenic
1051362445 9:16293255-16293277 CACTCATGCCTCTCCTTGTAAGG - Intergenic
1051585393 9:18721657-18721679 CACACATCCCTTACCTTGCTGGG - Exonic
1055490861 9:76804252-76804274 CACACGGGCCTCTCTTTGGCGGG + Intronic
1061488560 9:130933044-130933066 CACCCAAGCCCCTCCCTGGTGGG + Intronic
1062725022 9:138067901-138067923 CTCAGATGCCTCTGTTTGGTCGG - Intronic
1062726244 9:138075661-138075683 CACACTGGCCTCTCCCGGGTGGG + Intronic
1186961894 X:14745575-14745597 AACACCTTCCCCTCCTTGGTTGG + Intergenic
1187565356 X:20444281-20444303 CTAACATGCCTCTACTTGGATGG + Intergenic
1188979765 X:36716531-36716553 CACAGATTCCCCACCTTGGTTGG - Intergenic
1190411495 X:50141005-50141027 CAGAAATGCCTCTCCCTGGTAGG + Intergenic
1193726770 X:85049969-85049991 CACATATACCTCTCCTTTCTAGG + Intronic
1196560447 X:117140973-117140995 CTCACCTGCTACTCCTTGGTAGG - Intergenic
1197396677 X:125936197-125936219 GACACATGCATGTCCTTTGTAGG - Intergenic
1198186145 X:134255843-134255865 CACTCCTGCATCTCCTTTGTCGG + Intergenic
1201454027 Y:14148528-14148550 CTCACATTCCTTTCCTTGTTTGG + Intergenic