ID: 1082841384

View in Genome Browser
Species Human (GRCh38)
Location 11:57692950-57692972
Sequence CTTTTTCCACAGATGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 8, 2: 34, 3: 143, 4: 565}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082841379_1082841384 -5 Left 1082841379 11:57692932-57692954 CCGGTTTCATGGGAGACACTTTT 0: 1
1: 16
2: 489
3: 761
4: 1127
Right 1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG 0: 1
1: 8
2: 34
3: 143
4: 565
1082841372_1082841384 19 Left 1082841372 11:57692908-57692930 CCCTAACCTTTTTGGCAGCAGGG 0: 1
1: 92
2: 1163
3: 1688
4: 1361
Right 1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG 0: 1
1: 8
2: 34
3: 143
4: 565
1082841374_1082841384 18 Left 1082841374 11:57692909-57692931 CCTAACCTTTTTGGCAGCAGGGA 0: 17
1: 1080
2: 1683
3: 1342
4: 1004
Right 1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG 0: 1
1: 8
2: 34
3: 143
4: 565
1082841376_1082841384 13 Left 1082841376 11:57692914-57692936 CCTTTTTGGCAGCAGGGACCGGT 0: 3
1: 187
2: 1319
3: 1501
4: 1052
Right 1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG 0: 1
1: 8
2: 34
3: 143
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082841384 Original CRISPR CTTTTTCCACAGATGGGGGC TGG Intronic
900071899 1:778018-778040 TTTTTTCTAGAGATGGGGTCGGG - Intergenic
901304535 1:8223161-8223183 ATTTTTCCACAGCCGGGGGCTGG - Intergenic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901743174 1:11355691-11355713 CCACTCCCACAGATGGGGGCTGG - Intergenic
902179567 1:14677718-14677740 CTCTCTTCACAGATGGGAGCAGG - Intronic
902416762 1:16244349-16244371 ATTTTCCCACAGCTGAGGGCTGG + Intergenic
902703541 1:18189412-18189434 ATTTTTCCACAGACCAGGGCAGG + Intronic
903421658 1:23221922-23221944 CTATTTCCACTGCTAGGGGCAGG - Intergenic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
904203467 1:28836909-28836931 AGTTTTCCATCGATGGGGGCAGG + Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
904869581 1:33608115-33608137 GCATTTCCAAAGATGGGGGCTGG + Intronic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
907200165 1:52719721-52719743 CTTTTTGTACAGACGGGGTCTGG - Intergenic
907201327 1:52729150-52729172 CTGTTTTCACACATGGTGGCAGG + Intronic
907504044 1:54904215-54904237 TTTTTTGTACAGATGGGGTCAGG + Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
908156490 1:61358792-61358814 CTATCTCCACAGGTGGTGGCTGG - Intronic
908588718 1:65604880-65604902 ATTTTTCCACTAATGGGGGATGG - Intronic
909423901 1:75499219-75499241 ATTTTTCCATGGATGGGGGCCGG + Intronic
909533000 1:76701765-76701787 ATTTTTCCATGGATGGGGGCAGG + Intergenic
910687269 1:89930078-89930100 ATTTTTCCAGAAATGGGGGTTGG - Intronic
910824965 1:91397073-91397095 GTTTTTCCACAGATGGTTTCGGG - Intronic
910953775 1:92679241-92679263 ATTTCTCCACTTATGGGGGCTGG - Intronic
912399536 1:109378057-109378079 CTTTTTGTAGCGATGGGGGCGGG - Intronic
912878729 1:113388955-113388977 CATTTTGCAAAGATGTGGGCAGG - Intergenic
914255827 1:145960847-145960869 CTTTCTCCGCCCATGGGGGCGGG + Exonic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
914841540 1:151253156-151253178 TTTTTTTCAGAGATGGGGTCTGG + Intergenic
915411445 1:155703968-155703990 ATTTTTACAGAGATGGGGTCTGG - Intronic
915564160 1:156704783-156704805 CTTGTCTCACAGATGGGGGGTGG + Intronic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
916859351 1:168786326-168786348 TTTTTTTAAGAGATGGGGGCCGG - Intergenic
916874770 1:168957664-168957686 ACTTTTCCACAGATGGGCTCAGG + Intergenic
917031871 1:170701987-170702009 ATTTTTCCATGGATGGGGGAAGG + Intronic
917498215 1:175562023-175562045 CTTCTTCCACAGGTGATGGCAGG - Intronic
918460141 1:184767995-184768017 TTTTTTCCACGGATGGGGCAGGG - Intergenic
918699436 1:187589470-187589492 GTTTTTCCATGGATGGGGGATGG - Intergenic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
920580127 1:207098580-207098602 ACTTTTCCACGGATGGGGGTGGG + Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921322422 1:213954906-213954928 GTTTTTCCACAGACCGGGGTGGG + Intergenic
922063639 1:222115334-222115356 CTTTTGGTACAGATGGGGTCTGG + Intergenic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922266834 1:223991975-223991997 TTTTTTCTAGAGATGGGGTCGGG - Intergenic
922293257 1:224226818-224226840 ATTTTTCCACAGACAGGGTCAGG + Intergenic
922561574 1:226573318-226573340 CTTTTGTAACAGATGGTGGCGGG + Intronic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
922931755 1:229395590-229395612 CTTTTTCTGCAGCTGGGGGCTGG + Intergenic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
923077915 1:230626143-230626165 CTTTTTCCACCAATGGGCCCAGG - Intergenic
923090367 1:230735866-230735888 CTATTTACAAAGATGTGGGCAGG - Intergenic
923512556 1:234665002-234665024 ATTTTTCCACGGTTGGGGGGTGG - Intergenic
923616745 1:235544655-235544677 TTTTTTCCACAGATGTGGGGTGG - Intergenic
923986811 1:239390957-239390979 CTTTTTGTAGAGATGGGGTCTGG - Intronic
924202068 1:241670841-241670863 CTTTTTCCACGGACCAGGGCAGG - Intronic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063784274 10:9362873-9362895 ATTTCTCCACGGATGGGGGCGGG - Intergenic
1064202244 10:13294650-13294672 CCCTTTCCACAGAGGAGGGCAGG - Intronic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064558222 10:16568721-16568743 CTTTTTCCACAGACTGTGGGTGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065502163 10:26392781-26392803 CTTTTTTTAGAGATGGGGTCTGG + Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065726415 10:28671519-28671541 CATTTTCCACATATAGTGGCGGG - Intergenic
1065754640 10:28919957-28919979 GTTTTTCCACGGACTGGGGCAGG + Intergenic
1065768051 10:29050315-29050337 TTCTTTACAAAGATGGGGGCAGG - Intergenic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1066199465 10:33131279-33131301 ATTTTTCCACAGAGAGGGACAGG + Intergenic
1067844949 10:49712295-49712317 TTTTCTCCATAGATGGGGGGAGG - Intergenic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069321129 10:67172961-67172983 TTTTTTCCTGAGATGGGGTCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1070904659 10:80061097-80061119 TTTTTTCCAGGGTTGGGGGCAGG + Intergenic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072332696 10:94369233-94369255 ATTTTTCCACAGATCAGGGTGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074934637 10:118165866-118165888 GTTTTTCCACGGACAGGGGCGGG - Intergenic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1076853474 10:133104246-133104268 CTTCTGCCGCTGATGGGGGCTGG + Intronic
1077505141 11:2926587-2926609 ATTTTTCCACGGATGTGGGTGGG + Intergenic
1077860846 11:6178480-6178502 ATTTTTCCACAGACAGGGGAAGG - Intergenic
1078099629 11:8322319-8322341 GTTTTTCCACAGATCGGGTAGGG - Intergenic
1078149133 11:8743918-8743940 TTTTTTGTAGAGATGGGGGCGGG + Intronic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1078611408 11:12822614-12822636 CTTTTTCCAGGGCTGGAGGCTGG + Intronic
1079296541 11:19240480-19240502 CCTTTTCTACAGATGGGAGAGGG - Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080470231 11:32538353-32538375 ATTTTTCCATGGATGGGGGTCGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1081262396 11:40976844-40976866 TTTTTTCCACAGACTGGGGCAGG + Intronic
1081281182 11:41210840-41210862 ATTCTTCCACTGATGGGGGTTGG + Intronic
1082708842 11:56527915-56527937 ATTTTTCCATGGATGGGGGTTGG + Intergenic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1086804010 11:91217044-91217066 CTGTTTCCATGGATGAGGGCGGG + Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088185713 11:107166864-107166886 CTTTTTCCACAGATGTGGTCAGG + Intergenic
1089181390 11:116585387-116585409 CTTTTTCCACAGACCAGGGTGGG - Intergenic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1089730479 11:120515938-120515960 CCTTTTCCACAGATGAGGAAGGG + Intronic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1090974323 11:131668955-131668977 CTTGTTCCACTGGTGGTGGCCGG + Intronic
1091307314 11:134544593-134544615 CTTTTTCCATGGATGGTGGTGGG + Intergenic
1091956178 12:4645420-4645442 ATTTTTCCACGGATGGGAGTGGG + Intronic
1092006613 12:5075623-5075645 CTTGTTCCAGGGATGGGGGAAGG - Intergenic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092734293 12:11565526-11565548 ATTTTCCCACGGATGGGGGTTGG - Intergenic
1093176364 12:15917733-15917755 GTTTTTCCACAGACTGGGGTAGG + Intronic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093651698 12:21653420-21653442 ATTTTTCCACAGATGTGTGAGGG - Intronic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1095145907 12:38725934-38725956 GTTTCCCCACAGATGGGGGTGGG + Intronic
1095184370 12:39184722-39184744 ATTTTTTCACGGATGGGGGGTGG - Intergenic
1095322662 12:40847834-40847856 GTTTTTCCACGGATGGGGTGAGG + Intronic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095491051 12:42734219-42734241 ATCTTTCCATAGATGGGGGTGGG + Intergenic
1095757328 12:45783525-45783547 GTTTTTCCACAGACTGTGGCAGG + Intronic
1096118774 12:49072553-49072575 CTATTTACAAAGATGTGGGCAGG - Intergenic
1097110562 12:56655001-56655023 ATTTTTCCATGGATGGGGGTGGG - Intergenic
1097728995 12:63106502-63106524 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1097878072 12:64661975-64661997 TTTTTTTAAGAGATGGGGGCTGG - Intronic
1098284071 12:68890615-68890637 CTTTTTCCCCAGAGTGGGGTTGG - Intronic
1099033834 12:77560714-77560736 CAGTTTCCACAGAGGGGGCCAGG - Intergenic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101026428 12:100611552-100611574 GTTTTTCCACAGATTTGGGCGGG + Intronic
1101375565 12:104168413-104168435 ATTCTTCCACAGATGGGAGCAGG - Intergenic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102652200 12:114449869-114449891 CCTTTTCTCCAGATGGGGGGAGG - Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1102919373 12:116780285-116780307 GTTTTTCCACAGATCAGGGTGGG + Intronic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1103652673 12:122444940-122444962 TTTTTTTAACAAATGGGGGCTGG - Intergenic
1103865386 12:124047741-124047763 GTTTTTCTGCAGATGGGGGCAGG - Intronic
1104205205 12:126632131-126632153 CTATTTACACAGATGTGAGCAGG - Intergenic
1104257338 12:127151254-127151276 ATTTTTCCATAGACTGGGGCAGG + Intergenic
1105370419 13:19797280-19797302 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1105704546 13:22961002-22961024 CTTTGTCCGCAGATGGGCCCAGG + Intergenic
1106286501 13:28322537-28322559 CTTTATCCAAGCATGGGGGCAGG + Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106523443 13:30518917-30518939 ATTTTTGTAGAGATGGGGGCTGG + Intronic
1107052893 13:36070939-36070961 CTCTTTATAAAGATGGGGGCCGG - Intronic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1107938350 13:45363507-45363529 GTCCTTACACAGATGGGGGCAGG - Intergenic
1108820431 13:54342703-54342725 ATTTGTCCATGGATGGGGGCAGG - Intergenic
1110070419 13:71169254-71169276 CATTTTGAACAGATGGTGGCTGG + Intergenic
1110105461 13:71669570-71669592 TTTTTTCCACTGATGGGGGTGGG - Intronic
1110849971 13:80233698-80233720 ATTTTTCCATGAATGGGGGCAGG + Intergenic
1110909038 13:80932423-80932445 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1112385318 13:98934072-98934094 ATTTTTGGAGAGATGGGGGCGGG + Intronic
1112562130 13:100524247-100524269 CTCTTCCCACAGACTGGGGCAGG + Intronic
1113126316 13:106983222-106983244 ATTTTTCCACAAACTGGGGCTGG - Intergenic
1113252087 13:108464755-108464777 CTTTTTCAGCAGATGGATGCAGG + Intergenic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114897138 14:27005020-27005042 ATTTTTCCACGGATGGGGTGAGG - Intergenic
1115292263 14:31785524-31785546 ATTTTTCCATGGATGGGAGCAGG - Intronic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1116721205 14:48498137-48498159 CTTTTTCCACATATGGCAGAAGG - Intergenic
1117146324 14:52840050-52840072 CTTTTTCAACAAATGGTGGCGGG - Intergenic
1117559130 14:56917930-56917952 ATTTTTCCATATATGGGGGTGGG + Intergenic
1117706538 14:58475398-58475420 ATTTTTCCACAGACCAGGGCAGG - Intronic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1117767743 14:59100476-59100498 ATTTTTCCACAGACTGGGTCGGG + Intergenic
1118186351 14:63542498-63542520 CTTTATCCACTGGCGGGGGCGGG - Intronic
1118353402 14:64990588-64990610 CTATTTACAAAGATGTGGGCAGG - Intronic
1118676048 14:68185655-68185677 ATTTTTCCGTGGATGGGGGCGGG + Intronic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119454434 14:74742514-74742536 GTTTTTCCACAGATGGCAGTGGG + Intergenic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1121027623 14:90628117-90628139 CATTTTCCAAATCTGGGGGCGGG - Intronic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1122087804 14:99319340-99319362 CTTTTTGCAGAGGTGGGAGCGGG - Intergenic
1122139109 14:99651779-99651801 GTTTTTCAACAGATAGAGGCCGG + Intronic
1122144002 14:99677996-99678018 ATTTTTCCATGGATGGGGGTTGG + Exonic
1122170001 14:99864978-99865000 ATTTTTCCACAGAAGTGGGGCGG + Intronic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1122657345 14:103270909-103270931 CTGTCTCCCCAGATGGTGGCTGG - Intergenic
1202873593 14_GL000225v1_random:188230-188252 ATTTTTTTAGAGATGGGGGCAGG + Intergenic
1124114964 15:26831894-26831916 ATTTTTCCACCGATTAGGGCAGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1124940876 15:34216865-34216887 ATTTTTCCACAAATGTGAGCTGG + Intergenic
1125270445 15:37933207-37933229 CTCTTTCCTAAGATGGTGGCAGG + Intronic
1125318757 15:38459541-38459563 CTAATTCCACAGGTGCGGGCTGG + Intronic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1126195790 15:45929260-45929282 CTTCTGACAAAGATGGGGGCGGG + Intergenic
1126399575 15:48255799-48255821 CTTTATCCACAGATGTGAACTGG + Exonic
1126608663 15:50506454-50506476 TTTTTCCCATGGATGGGGGCCGG - Exonic
1126739064 15:51759793-51759815 CTATTTACAAAGATGGGGGGAGG + Intronic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129218103 15:74113012-74113034 ATTTTTCTACAGACGGGGTCAGG + Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129452835 15:75660239-75660261 TTGTGGCCACAGATGGGGGCTGG + Exonic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1130195730 15:81778700-81778722 ATTTTTCCACAGACCAGGGCGGG + Intergenic
1130685399 15:86032644-86032666 CTGTTTCCTGAGCTGGGGGCTGG - Intergenic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1131454613 15:92573385-92573407 CTATTTCCACAGAGAGAGGCCGG - Intergenic
1131846521 15:96495102-96495124 CTATTTACAAAGATTGGGGCAGG + Intergenic
1132032118 15:98446852-98446874 GTTTTTCCACGGATGGGGCAGGG - Intronic
1132050305 15:98602210-98602232 GTTTTTCCACAGATGTGGTGTGG - Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1133650387 16:7807179-7807201 GTTTTTCCACCCATGGAGGCTGG - Intergenic
1133909339 16:10050728-10050750 GTTTTTCCACAGACCGGGGTTGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1134459873 16:14421700-14421722 AATTTTCCACGGATGGGGGCGGG - Intergenic
1135191405 16:20357728-20357750 ATTTTTCCAGGGATGGGGGTGGG + Intergenic
1135605884 16:23824246-23824268 ATCTTTTCACAGATGTGGGCGGG + Intergenic
1135693514 16:24565653-24565675 ATTTTTCCATGGACGGGGGCAGG - Intronic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1137930713 16:52584668-52584690 CTTTTTGCAAAGATGTGAGCAGG - Intergenic
1138309908 16:56014689-56014711 CTTTTTCGTCAGAATGGGGCAGG + Intergenic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1138789075 16:59881247-59881269 CCATTTCCAAAGATGTGGGCAGG + Intergenic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140358621 16:74326400-74326422 ATTTTTCCGCAGATTGGGACGGG + Intergenic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1141187602 16:81798948-81798970 CTTTTCCCACTGGTGGAGGCTGG - Intronic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1142534829 17:606874-606896 GTTTTTCCAGAGGTGGGGGTGGG - Intronic
1142585820 17:972650-972672 CTTTGTGCACAGCTGGGGTCGGG - Intronic
1142618169 17:1148684-1148706 CTTTTTCCACGGACCGGGGAAGG - Intronic
1143279481 17:5741809-5741831 ATTTTTCCACGGACGGGGGTGGG + Intergenic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1145184656 17:20784056-20784078 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
1146253956 17:31378110-31378132 CTTTCTCCACTGATTGGGGGAGG - Intronic
1146738118 17:35257101-35257123 ATTTTTTCACGGATGGGGGTTGG - Intronic
1147271400 17:39274454-39274476 CTTTTTGTAGAGATGGGGTCAGG - Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1147642555 17:42012976-42012998 TTTTTTACAGAGATGGGGGGCGG + Intronic
1147927163 17:43953178-43953200 CTTTTCCCATACCTGGGGGCGGG + Exonic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1148120192 17:45204761-45204783 CTTATTCAACAAATGGTGGCTGG - Intergenic
1148411727 17:47473016-47473038 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1149040968 17:52187657-52187679 ATTTTTCCATAGATAGGGGCAGG + Intergenic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1149360436 17:55889412-55889434 AATTTTCCACAGATGTGGGCAGG - Intergenic
1149802260 17:59580783-59580805 CTGTTTCAAAAGAAGGGGGCTGG + Intronic
1149844231 17:59994706-59994728 CTGTTTCAAAAGAAGGGGGCTGG - Intergenic
1149849978 17:60028483-60028505 CTCTGTCCACAGAAGGGGGAGGG - Intergenic
1149860189 17:60118041-60118063 CTCTGTCCACAGAAGGGGGAGGG + Intergenic
1150209053 17:63431741-63431763 ATTTTTCCACAGACCAGGGCTGG - Intergenic
1150806743 17:68325491-68325513 GTTTTTCCACAGACAGGGGTTGG - Intronic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1151439542 17:74119295-74119317 CTTTTTACCAAGATGTGGGCAGG + Intergenic
1151836711 17:76586648-76586670 ATTTTTCCACGGAGGGGGGTGGG + Intronic
1151882539 17:76904026-76904048 CTCTTTCCAGACATGAGGGCTGG + Intronic
1151994506 17:77600259-77600281 CTTTTTCCATAGCTAAGGGCAGG + Intergenic
1152155935 17:78632774-78632796 TTTTTTCCATGGATGGGGGCAGG - Intergenic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153845251 18:9043608-9043630 TTTTTTCCATGGATGGGGGTTGG - Intergenic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1155459966 18:26067851-26067873 ATTTTTCCACTGATGGTGGCCGG + Intronic
1155908299 18:31478795-31478817 ATTTTTCCACAGACGGCGGCAGG + Intergenic
1156151982 18:34253482-34253504 TTTCTTCCACAGATGGGAGAGGG - Intergenic
1156774664 18:40772372-40772394 ATTTTTCCATGGATGGGGGATGG + Intergenic
1156806856 18:41194550-41194572 CTGTTTCCACTCATGGTGGCAGG - Intergenic
1157171409 18:45409818-45409840 ATTTTTCCACAGACCGGGGTTGG + Intronic
1157297981 18:46459612-46459634 CTTCCCCCACAGATGGGGACAGG + Exonic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1158000702 18:52615139-52615161 CATTTTCCTGAGATGTGGGCAGG + Intronic
1158014438 18:52766887-52766909 CTTTTACCATTGATGGGGACAGG - Intronic
1158664569 18:59420845-59420867 CTTCTCCCACAGCTGGGGTCAGG + Intergenic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159014868 18:63093090-63093112 ATTTTTCCACGGACAGGGGCCGG - Intergenic
1159031132 18:63233461-63233483 GTTTTTCCATAGACGGGGGTGGG + Intronic
1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG + Intronic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1159519324 18:69497367-69497389 GTGTTTCCAGAGATTGGGGCTGG - Intronic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160223199 18:76992197-76992219 GTTTTTCCATGGATGGGGGTGGG + Intronic
1160413243 18:78688830-78688852 CTTTTCCTGCAGCTGGGGGCTGG - Intergenic
1160662338 19:306894-306916 CATTCTCCACAAATGGGAGCAGG - Intronic
1161204461 19:3033838-3033860 CTTTTTGTAGAGATGGGGGGTGG - Intronic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1161786422 19:6328969-6328991 ATTTTTATACAGATGGGTGCTGG - Intronic
1161903654 19:7138552-7138574 TTTTTTGCAGAGATGGGGTCTGG + Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162713317 19:12612214-12612236 TTTTTTTAACAGATGGGGTCTGG + Intronic
1163414940 19:17180743-17180765 CTTTTGCCAGAAATGGGGACTGG - Intronic
1163535786 19:17875594-17875616 TTTTTTGTAGAGATGGGGGCGGG - Intronic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1165385705 19:35509679-35509701 CTTATACCACAGATGGGGCTGGG - Intronic
1166130831 19:40744673-40744695 CTCTGTCCCCAGATGCGGGCTGG - Exonic
1166265667 19:41682722-41682744 CTTTTTCCCCAGATGAGAGGAGG - Intronic
1166582622 19:43915784-43915806 GTTTTTCCACAGACTGGGGTCGG - Intronic
1166612886 19:44215068-44215090 ATTTTTCCACGGATGGGGGCGGG - Intronic
1166715857 19:44967139-44967161 TTTTTTACAGAGATGGGGTCAGG - Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167812776 19:51849115-51849137 CTATTTCCACAGTTTGGGGAAGG + Intergenic
1168326553 19:55541448-55541470 CTTCCTCCACAGCCGGGGGCTGG - Exonic
925958942 2:8996752-8996774 CTATTTACAAAGATGTGGGCAGG - Intronic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
927121605 2:19969212-19969234 CTTATTACAGAGATGTGGGCAGG - Intronic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927259452 2:21072449-21072471 GTTTTTCCACGGATGGGGATCGG + Intergenic
928323946 2:30305208-30305230 TTTTTTCCAGAGATAGGGTCTGG + Intronic
928804491 2:35133575-35133597 CTTTTTACTTAGATGGGTGCAGG + Intergenic
928987955 2:37198832-37198854 ATTTTTATACAAATGGGGGCAGG - Intronic
929530156 2:42745553-42745575 ATTTTTACAGAGATGGGGGCAGG + Intronic
930194539 2:48496235-48496257 ATTTGTCCACAGTTGGTGGCTGG + Intronic
931891175 2:66673925-66673947 CATTTTCCACAAATATGGGCTGG + Intergenic
932192665 2:69754020-69754042 CTCTTCCCACAGATGGATGCTGG - Intronic
932796673 2:74701627-74701649 CTATCTTCACAGCTGGGGGCAGG + Intergenic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933538745 2:83611430-83611452 TTTTTTCCCCAAATGTGGGCAGG + Intergenic
933693604 2:85198471-85198493 CATTTTCCACAGGCAGGGGCTGG + Intronic
933776383 2:85773646-85773668 CTTTTTCCACTGCTGGGGTGAGG - Intronic
933845543 2:86323631-86323653 GTTTTTCCATGGATGGGGGTTGG - Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
934080225 2:88461314-88461336 CTTTTTCAAAAAATGGGGTCAGG - Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935083543 2:99822824-99822846 CTTTTTCCAGAGTTCGGGGTGGG + Intronic
935360853 2:102245325-102245347 CCTCTTCCTCAGGTGGGGGCTGG - Intergenic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
936474851 2:112831197-112831219 CTTTTCCTAGGGATGGGGGCGGG + Intronic
937014192 2:118588669-118588691 ATTTTTCCACAGACCAGGGCAGG + Intergenic
937167202 2:119831042-119831064 ATTTTTCCATGGATGGGGGGTGG + Intronic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
938277456 2:130038555-130038577 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938328426 2:130429358-130429380 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938361520 2:130692136-130692158 CTTCAGTCACAGATGGGGGCTGG + Intergenic
938437927 2:131298825-131298847 CTTCAGTCACAGATGGGGGCTGG + Intronic
938985373 2:136570414-136570436 GTTTTTCCACAGATGTGGATGGG + Intergenic
939535111 2:143417988-143418010 CTTGTTCTACAGATGATGGCAGG - Intronic
939669353 2:144991031-144991053 GTTTTTCCAGTGATGGGAGCAGG - Intergenic
940039468 2:149345102-149345124 CTTTTTTCAGAGATGGGGTCGGG - Intronic
940534586 2:154924318-154924340 ATTTTACCACAGACTGGGGCGGG + Intergenic
941225569 2:162842714-162842736 CTTTTTCTATAGATGGGGTCTGG + Intergenic
941367308 2:164623102-164623124 ATTTTTCCACGGATGGGGTGGGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943162298 2:184269847-184269869 ATTTTTCCATGGATGGGGGTGGG + Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944260369 2:197669522-197669544 GTTTTTCTACAGATGTGGGTGGG + Intronic
944293111 2:198030430-198030452 GTTTTTCCACAGTTGGGGAAAGG + Intronic
944313496 2:198261419-198261441 TTTTTTCCAGGGATGAGGGCGGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946335015 2:219030519-219030541 CCTTCTCCTCAGCTGGGGGCTGG - Intronic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947111721 2:226725854-226725876 TTTTTTTCACATATGGGGGATGG + Intergenic
948535789 2:238645686-238645708 ATTTTTCCACAGACCGGGGAAGG - Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948734740 2:239994629-239994651 GTTTTTACACAGACTGGGGCGGG - Intronic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1169785649 20:9356936-9356958 TTTTTTGCAGAGATGGGGTCTGG - Intronic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1172627254 20:36354308-36354330 TGTTTTCTACAGATGGGGTCTGG - Intronic
1173051958 20:39571866-39571888 GTTTTTCCACAGGTCGGGGTCGG + Intergenic
1173515426 20:43662345-43662367 TTTTTTGTACAGACGGGGGCGGG + Intergenic
1173697209 20:45028502-45028524 TTTTTTCCAAAGATGAGGTCTGG + Intronic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174635537 20:51996269-51996291 GTTTTTCCACAGACTGGGGTTGG + Intergenic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1174955200 20:55090249-55090271 CTTGTTCCACAGCTAGGTGCAGG + Intergenic
1175317900 20:58064549-58064571 CTTGTTCCACAGTTGGGGATCGG + Intergenic
1175778470 20:61667491-61667513 CTGTTTCCAGAGAGGGTGGCCGG + Intronic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1176696786 21:9987376-9987398 TTTTCTCCCCTGATGGGGGCAGG - Intergenic
1177396119 21:20538200-20538222 GTTCCTGCACAGATGGGGGCAGG - Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1177842984 21:26255401-26255423 CTGTGTCCACACATGGTGGCAGG + Intergenic
1178202423 21:30422637-30422659 GTTTTTCCACAGATTGGAGCAGG + Intronic
1178319776 21:31596583-31596605 ATTTTTCCATACATGGGGGTGGG - Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1178497673 21:33101224-33101246 CTGTGTCCACAGAGGTGGGCAGG + Intergenic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180284507 22:10731367-10731389 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181048103 22:20226203-20226225 CCTTTCCCAGAGCTGGGGGCTGG - Intergenic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1183503663 22:38196443-38196465 ACTTTTCCACAGATGAGGGTGGG + Intronic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1184567483 22:45300779-45300801 CTTTTTGCACAGGTGAGGTCAGG - Intergenic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1184886943 22:47352252-47352274 GTGTTTCCACAGATGAGGCCAGG - Intergenic
949186940 3:1203246-1203268 CTTTTCTCACAGATGGGGGCAGG - Intronic
949258340 3:2077440-2077462 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949762723 3:7488931-7488953 CTTTTTACATAGATGGTGACAGG + Intronic
950952825 3:17018537-17018559 TTTTTTCAACAGATGGGGCCTGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952166978 3:30760793-30760815 GTTTTTCTTCAGGTGGGGGCAGG + Intronic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
953154531 3:40357054-40357076 CTCTTTACACAGATGTGGGCAGG - Intergenic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953384510 3:42499027-42499049 CTTTATCCATAGAGCGGGGCTGG - Intronic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
953931863 3:47009564-47009586 CTTTTTGCACAGTCTGGGGCGGG + Exonic
954990501 3:54836957-54836979 TTGTTTCCCCAGCTGGGGGCTGG + Intronic
955913033 3:63877922-63877944 CTTTTTCCACAGGAGAGGACTGG - Intronic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
956696961 3:71926703-71926725 CTGTTTCTAAAGATGTGGGCAGG + Intergenic
957601428 3:82339540-82339562 CTTTTTCAACTGATGATGGCTGG - Intergenic
958178241 3:90023828-90023850 CTATTTCCAGAGATGTTGGCAGG - Intergenic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
959106531 3:102071160-102071182 ATTTTTCCATGGATGGGGGAGGG + Intergenic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960166101 3:114403229-114403251 CTTTCTTCACAGAAGGGAGCTGG + Intronic
960672910 3:120169344-120169366 GTTTTTCCACAGATAGTGGTGGG - Intronic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
961488775 3:127236253-127236275 AATTTTCCACAGATGAGGGGAGG - Intergenic
961580809 3:127880478-127880500 ATTTTTCCACTGATGAGGGTGGG + Intergenic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
962574628 3:136745439-136745461 ATTTTTCCACGGATGGGGTGGGG + Intronic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
962950735 3:140216215-140216237 ATTTTTCCATGGATGGGGGTGGG - Intronic
963071067 3:141305733-141305755 CTGTGTCCACACATGGGGGTGGG - Intergenic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
963605036 3:147406188-147406210 CTTTATCCACGGTTGGGGGAGGG + Intronic
963744817 3:149115504-149115526 GTTTTTCCACAGACTAGGGCAGG - Intergenic
963954217 3:151235272-151235294 CTTTGTAAACTGATGGGGGCAGG + Intronic
964129974 3:153276039-153276061 CTTAGTCCACAGAGTGGGGCTGG - Intergenic
964209624 3:154212579-154212601 ATTTTTCCACAGACGGGTGGGGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
965930004 3:174030674-174030696 CTTAATCCACAGGTGGTGGCAGG + Intronic
965946069 3:174242802-174242824 ATTTTTCCATGGATGGGGGCGGG - Intronic
966158696 3:176945857-176945879 TTTTTTCCATGGATGGGGGGTGG - Intergenic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
967965429 3:194956732-194956754 CTGTTTCCCCAGGTTGGGGCTGG - Intergenic
968963456 4:3757538-3757560 CTTTGGCCACAGCTGGGGACAGG + Intergenic
969144290 4:5107408-5107430 CAATTTCCACAGACGGGGGAAGG - Intronic
969472147 4:7395226-7395248 CCGTTTCCACAGATGGCAGCTGG - Intronic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970274711 4:14385955-14385977 CCTTTTCCAGAGTTAGGGGCAGG - Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
970897585 4:21121233-21121255 CTTTTTCTGCATAAGGGGGCCGG - Intronic
971917368 4:32890343-32890365 ATTTTTCCATAGACAGGGGCAGG + Intergenic
972633603 4:40863009-40863031 CTGTTTCCAGAGAAGGGGACTGG + Intronic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
973095968 4:46200177-46200199 GTTTTTCCACAGATGTTGGGTGG - Intergenic
973312666 4:48726384-48726406 AAATTTCCACAGATGCGGGCGGG + Intronic
973783826 4:54316884-54316906 TTTTTTTAAGAGATGGGGGCCGG + Intergenic
975070688 4:70133850-70133872 ATTTTTCCACGGATGAGGGCGGG - Intronic
975490586 4:74984078-74984100 CTTTTTCCTCAGAGGGTGTCTGG + Intronic
975646952 4:76555176-76555198 ATTTTTCCACGGATGGGGTGTGG - Intronic
975868993 4:78757664-78757686 CATTGTCCTCTGATGGGGGCAGG + Intergenic
976670143 4:87643233-87643255 TTTTTTGTAGAGATGGGGGCTGG - Intergenic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
977923585 4:102672852-102672874 GTTTTTCTACAGATTGGGGGTGG - Intronic
978754473 4:112287076-112287098 CTTTTTCCACAGACTGGGGTTGG + Intronic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
979651467 4:123136964-123136986 ATTTTTCCACAGGTGTGGGGCGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
981968552 4:150636607-150636629 CTTTGTCCACTGAGGGGGCCTGG - Intronic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982747355 4:159118491-159118513 CTTTTTCCACAGGGTTGGGCGGG - Intronic
982887085 4:160795295-160795317 CTTCTTCCACAAATGGGTTCTGG - Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983097827 4:163585824-163585846 CTTTATCCACTGGTGGAGGCAGG + Exonic
983139078 4:164125916-164125938 GTTTTTCCACAGAATGGGGCAGG - Intronic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984364929 4:178786273-178786295 ATTTTTCCATGGATGGGGGGTGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
986550951 5:8954997-8955019 CTTTTTCCACTGTAGGGGGCAGG + Intergenic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987310115 5:16673914-16673936 ATTTTTAGACTGATGGGGGCTGG + Intronic
987910605 5:24139181-24139203 ATTTTTCCAAGGATGAGGGCGGG + Intronic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
988813599 5:34808792-34808814 ATTTTTCCATGGATGGGGGTGGG + Intronic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990972147 5:61519804-61519826 GTTTTTCCACGGATGGGGGGTGG + Intronic
991065451 5:62419814-62419836 CTTTTTGTAGAGATGGGGTCTGG - Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
993023538 5:82620762-82620784 TTTTTTCAACAAATGGGCGCTGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
995225186 5:109692774-109692796 GTTTTTCCACAGACAGGGGTGGG + Intronic
995354429 5:111222715-111222737 TTTTTTCCACAGACAGGGGGTGG - Intergenic
995548758 5:113258615-113258637 ATTTTTCCACAGACAGTGGCAGG - Intronic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996331179 5:122330734-122330756 ATTTTTCCATAGTTGGGGGAGGG + Intronic
996458970 5:123719383-123719405 TTTTTTCCGCAGATAGGGGAAGG - Intergenic
996558603 5:124804258-124804280 GTTTTTCCACAGGTAGGGGGAGG - Intergenic
997715619 5:136040550-136040572 ATATTTCCCCAGATGGTGGCAGG - Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998240787 5:140442405-140442427 ATTTTTCCACACGTGGGGGAGGG + Intronic
998564940 5:143208561-143208583 CTTTTTCCACAGTAGGGTTCAGG - Intronic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999702360 5:154239569-154239591 ATTTTTCCACGGATGGGGACCGG - Intronic
999725711 5:154435651-154435673 ATTTTTCCACGGTTGGGGGTGGG - Intergenic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
1001444589 5:171773532-171773554 CTTTTCCCTCACATGGGAGCTGG + Intergenic
1002142259 5:177149596-177149618 GTTTTTCCACAGGTGGGAGTGGG + Intronic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1002765049 6:232224-232246 ATTTTTCCACGGACTGGGGCAGG + Intergenic
1002785123 6:394084-394106 CTCTGCCCACAGGTGGGGGCTGG - Intronic
1003314878 6:5003488-5003510 CTTTTTCCCCAAATCAGGGCGGG - Intronic
1003490681 6:6618913-6618935 CTTTTTCCACAAAGGTGGGGAGG + Intronic
1003530882 6:6936511-6936533 CTCTTTACAAAGATGGGGGCAGG - Intergenic
1003967446 6:11266457-11266479 CTTTTTCCAGAGTTTGGGGCAGG - Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005086819 6:22015397-22015419 ATTTTTCCACGGATGGCGGTGGG - Intergenic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1006120198 6:31799739-31799761 CTTTATCCACATATGGGCTCTGG - Intronic
1006443043 6:34063827-34063849 CTGTCTCCCCAGATGGGGGGAGG - Intronic
1006507496 6:34498934-34498956 GTTTTTCCACAGACTGGGGTTGG + Intronic
1006512822 6:34530783-34530805 ATTTTTCCACGGATGGGAGCGGG + Intronic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1007273302 6:40654814-40654836 GTTTTCCCACAGACAGGGGCAGG + Intergenic
1007393949 6:41566660-41566682 CTTTTTCCCCAGGTGGGACCAGG - Intronic
1007811827 6:44491752-44491774 CCTTCTCCAGAGATGGGGGTGGG - Intergenic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008523902 6:52388443-52388465 ATTTTTCCACGTATGGGGGCTGG - Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1009052195 6:58289653-58289675 GTTTTTCCACAGACTGGGGTTGG + Intergenic
1009517725 6:64641215-64641237 CTTCTTGCACAGATGGCAGCAGG + Intronic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011312140 6:85991034-85991056 CAGTTTTCACAGATGAGGGCAGG + Intergenic
1011569914 6:88724546-88724568 ATTTTTCCACAGACAGGGGAAGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1011814528 6:91172990-91173012 TTTTTTCCACAGAGGGTGGCTGG + Intergenic
1012497883 6:99854784-99854806 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1013333649 6:109133219-109133241 GTTTTTCCACAGATGCGGCAGGG + Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1014010436 6:116469413-116469435 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1014102794 6:117530285-117530307 GTTTTTCCACAGACGGGGTGGGG + Intronic
1014403172 6:121015863-121015885 CTTGTTCCACAGAGTGGGGATGG - Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1015201194 6:130583294-130583316 ATTTTTCCACAGGATGGGGCAGG + Intergenic
1015285985 6:131487107-131487129 CTTCTTCCACTCATGGTGGCAGG + Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015629674 6:135219451-135219473 CTGATACCACAGATGTGGGCAGG + Intergenic
1015819579 6:137246025-137246047 GTTTTTCCACAGATGAGGGCAGG + Intergenic
1016029910 6:139326558-139326580 CTTTCTCCAGGAATGGGGGCAGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017318229 6:153057583-153057605 ATTTTTCCACGGATGGGTGTGGG + Intronic
1017638669 6:156468560-156468582 TTGTGTCCACAGATGGGGCCTGG - Intergenic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019981609 7:4625572-4625594 TTTTTTAAAGAGATGGGGGCTGG - Intergenic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021311084 7:19097669-19097691 ATTTTTGCACATATGTGGGCTGG + Intronic
1022358112 7:29634968-29634990 CTCTTTCCCCAGATAGAGGCTGG + Intergenic
1023139899 7:37091471-37091493 CTTTTTCCCCAGCTAGGAGCTGG + Intronic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023199700 7:37682992-37683014 ATTTTTCCACAGACAGGGGTGGG - Intergenic
1023282727 7:38588129-38588151 CTTTTTCTAGAGATGGGGTTTGG + Intronic
1023573543 7:41599193-41599215 CTTTTTGTACAGATGGGATCGGG - Intergenic
1023728770 7:43170358-43170380 ATTTTTCCACAGACAGGGGTGGG - Intronic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1026544498 7:71310052-71310074 CGTCTTACACAGATGGCGGCAGG - Intronic
1027613554 7:80392804-80392826 TTTTTTCCACGGATTGGGGTGGG + Intronic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1029140085 7:98403009-98403031 TTTTTTGCAGAGATGGGGGTGGG - Intergenic
1029478245 7:100797947-100797969 GTTTTTGTAGAGATGGGGGCGGG + Intergenic
1030350115 7:108475326-108475348 GTTTTTCCGCACATGGGGGCGGG - Intronic
1030479263 7:110081879-110081901 ATTTTTCCATGGATGGGGGCAGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032302411 7:130699933-130699955 CTTTTTCCACAGAACGCTGCAGG - Intergenic
1032361291 7:131257773-131257795 CTTTTTCCCCACATGGGAGAAGG - Intronic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1034360019 7:150486997-150487019 TTTTTTTCAGAGATGGAGGCAGG + Intergenic
1034899277 7:154897503-154897525 CTTTCTCCACAGAGCTGGGCTGG + Intergenic
1035826264 8:2647236-2647258 CCTTTTTCAGAGATGTGGGCTGG + Intergenic
1036132707 8:6131276-6131298 ATTTTTCCACGGATGAGGACGGG + Intergenic
1036176532 8:6543510-6543532 TTTATTCCGCAGATGGGAGCTGG - Intronic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1037457510 8:19078695-19078717 CTTTTTGCTCTGATGTGGGCTGG - Intronic
1037603585 8:20419311-20419333 GTTTTTCCATGGATGGGGGGTGG + Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1037809280 8:22077040-22077062 GTATGTCCACAGCTGGGGGCAGG + Intronic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038195055 8:25359727-25359749 ATTTTTCCACGGATGGGGGCAGG - Intronic
1038696805 8:29813462-29813484 ATTTTTCCATGGATGGGAGCAGG - Intergenic
1040955808 8:52978733-52978755 CAGTTTCAACAGATTGGGGCTGG + Intergenic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041573875 8:59370478-59370500 CTTTTTCCACAACAGGGAGCAGG - Intergenic
1041702898 8:60811084-60811106 ATTTTTCCACGGACTGGGGCGGG - Intronic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1041913581 8:63116101-63116123 TTTTTTGTACAGATGGGGTCTGG + Intergenic
1042110193 8:65373383-65373405 ATTTTTCCACATTTGTGGGCTGG - Intergenic
1042225935 8:66514344-66514366 GTTTTTGAACAGATGGGGACAGG - Intronic
1043005579 8:74814352-74814374 ATTTTTCCACAGACGAGGGAGGG + Intronic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044356165 8:91225027-91225049 CTTTTTCCCCTGCTGGGGCCAGG - Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045872905 8:106946410-106946432 CTTTTTCCACAGATTGGTCCAGG + Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1047981010 8:130182131-130182153 CTTTCTCCACTGATGTGGGTGGG + Intronic
1048159735 8:132004509-132004531 GTTTTTCCAAGGATGGGGACTGG - Intronic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1048601847 8:135926854-135926876 CTATTTCCAGAGGTGAGGGCAGG - Intergenic
1048800186 8:138187853-138187875 CTTTCTCCAGAGATCGGGGCCGG - Intronic
1049367257 8:142246410-142246432 CTGACTCCTCAGATGGGGGCAGG - Intronic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1050850510 9:10279067-10279089 CTTTTACCATACATGGGGCCAGG - Intronic
1051212430 9:14758658-14758680 CTTTTTCATCAGATGGTGGGGGG + Intronic
1051332124 9:16033691-16033713 GTTTTTCCACAGACAGGGGGTGG - Intronic
1051372803 9:16372672-16372694 CCTTTTCCTCAGATGGGGAAAGG + Intergenic
1051378608 9:16431727-16431749 ATTTTTCCACAGATGTGAGTAGG + Intronic
1051870815 9:21735686-21735708 ATGTTTCCACAAAGGGGGGCTGG + Intergenic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1053066881 9:35075285-35075307 CTTTTTCCTCAGGTGTGGCCCGG + Exonic
1053270528 9:36746357-36746379 ATCTTTCCCCAGGTGGGGGCTGG - Intergenic
1053633761 9:39973222-39973244 TTTTCTCCCCTGATGGGGGCAGG - Intergenic
1053771987 9:41490278-41490300 TTTTCTCCCCTGATGGGGGCAGG + Intergenic
1054210126 9:62277475-62277497 TTTTCTCCCCTGATGGGGGCAGG + Intergenic
1054314869 9:63571453-63571475 TTTTCTCCCCTGATGGGGGCAGG - Intergenic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055409979 9:76018577-76018599 ATTTTTCCACGGATGTGGGGTGG - Intronic
1055602148 9:77931064-77931086 ATTTTTCCAGGGATGGGGGTCGG - Intronic
1055968250 9:81886367-81886389 CTCTTTCCACAAATGGTGGTGGG - Intergenic
1056325219 9:85472288-85472310 ATTTTTCCACAGACCAGGGCAGG - Intergenic
1056958122 9:91098909-91098931 GTTTTTCCATGGATGGGGGTAGG - Intergenic
1057880285 9:98787984-98788006 CCTTCTCCACAAATGGGTGCTGG - Intronic
1057913134 9:99035535-99035557 CCTATTGCACAGTTGGGGGCTGG - Intronic
1060333950 9:122704153-122704175 TTTTTTCCACGGATGGTGGGAGG - Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1061117015 9:128620216-128620238 CTGCTTCCACATCTGGGGGCAGG - Intronic
1061123486 9:128658899-128658921 GTTTTTGTAGAGATGGGGGCAGG + Intergenic
1061306245 9:129734909-129734931 TTTTTCTAACAGATGGGGGCGGG - Intergenic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061640746 9:131952863-131952885 CTGTTTCCAAAGGTGTGGGCAGG - Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062395221 9:136350070-136350092 CTTGTTCACCAGTTGGGGGCTGG + Intronic
1203730863 Un_GL000216v2:88307-88329 ATTTTTTTAGAGATGGGGGCAGG - Intergenic
1185728139 X:2439480-2439502 ATTTTTCCACTGATGTGGGGTGG + Intronic
1186050215 X:5584474-5584496 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1186489219 X:9958483-9958505 CTTCTGCCACAGAAGGGGACTGG + Intergenic
1186760475 X:12717340-12717362 GTTTTTCCAGAAATGGGGGTGGG - Intronic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1188283932 X:28305112-28305134 GTTTTTCCACAGATGTGGGAAGG + Intergenic
1188379247 X:29471156-29471178 CTTTTTCCAAAGGAGGGGGTGGG + Intronic
1190161206 X:48032672-48032694 CTCTCTCCGCAGATGGTGGCAGG - Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192180812 X:68914556-68914578 CTTCTCCCTCAGCTGGGGGCAGG + Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1193308106 X:79973181-79973203 CATCTTTCACAGATGGTGGCAGG - Intergenic
1193599604 X:83493983-83494005 ATTTTTCCACAGACAGGTGCTGG - Intergenic
1193669655 X:84368782-84368804 TTTTTTCCACGGATGAGGGTGGG + Intronic
1195124306 X:101790289-101790311 ATTTTTCCACCGATGGGGTGTGG - Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195768866 X:108327326-108327348 ATTTTTCCATAGAAGGGGCCGGG - Intronic
1196782163 X:119393285-119393307 CTTCTTACACAGATGGCAGCAGG + Intergenic
1196866159 X:120073095-120073117 CTTTTTCCACTCTTGGGTGCAGG + Intronic
1196876938 X:120163186-120163208 CTTTTTCCACTCTTGGGTGCAGG - Intronic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197641817 X:128975889-128975911 CTTGTTCCACTGAAGGGCGCTGG + Intergenic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1198099530 X:133412794-133412816 CTTTTTCCTGAGATGCTGGCTGG + Intronic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic
1200720158 Y:6596825-6596847 CTTTGGCCAGAGATCGGGGCAGG - Intergenic