ID: 1082842333

View in Genome Browser
Species Human (GRCh38)
Location 11:57699670-57699692
Sequence ACTAGAGAGTAGTAGTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082842332_1082842333 20 Left 1082842332 11:57699627-57699649 CCTAAAAGTATTTGCTTGGGAGT 0: 1
1: 0
2: 2
3: 16
4: 149
Right 1082842333 11:57699670-57699692 ACTAGAGAGTAGTAGTACATAGG 0: 1
1: 0
2: 0
3: 10
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082842333 Original CRISPR ACTAGAGAGTAGTAGTACAT AGG Intronic
902528125 1:17072569-17072591 AGCAGAGAGTAGAAGCACATAGG - Intronic
902854373 1:19189969-19189991 TCTAGAGAGTATTAGAACAGGGG - Intronic
907862303 1:58365292-58365314 ACAAGAGAGTCATAGTAGATAGG + Intronic
908108367 1:60870243-60870265 AAAAGATAGTAGAAGTACATAGG - Intronic
908547440 1:65175683-65175705 CCTACAGAGTAGGATTACATTGG - Intronic
913252049 1:116919866-116919888 ACTAGTGAGTAGAAGGACAAGGG - Intronic
915682365 1:157593898-157593920 GCTAGATAGTAGTATTATATTGG - Intronic
915931634 1:160064010-160064032 GCTAGTGAGTAGTAGAACAGAGG + Intronic
918231367 1:182535937-182535959 ACCAGAGAGTAGTAGTGGAGCGG - Intronic
920724481 1:208421097-208421119 ACTAGAGAGAAGTAGTGCTTTGG + Intergenic
923601572 1:235407765-235407787 AGTAGAGAGCAGGAGTACCTAGG - Intronic
1062797747 10:357412-357434 ACTAGAAAGGAGTAGTTCAGGGG + Intronic
1063768540 10:9171236-9171258 CCTAGAGAGTAGTAGCAGAAAGG - Intergenic
1064670065 10:17704272-17704294 ACTAGAGAGAATAAATACATGGG + Intronic
1065719326 10:28610546-28610568 ACTAGATAGGAGTAATACAATGG - Intronic
1078476854 11:11637731-11637753 ACTAGAAAGTAGCAGAACCTGGG + Intergenic
1078504383 11:11921657-11921679 AATAGAGATCAGTAGTAGATTGG + Intronic
1082842333 11:57699670-57699692 ACTAGAGAGTAGTAGTACATAGG + Intronic
1084382333 11:68820833-68820855 ACTACACAGTAGTACTACACAGG + Intronic
1092488212 12:8921188-8921210 AGTAGAGAATAGTAGTACAAGGG + Intronic
1096501633 12:52067433-52067455 ATTGGAGAGTGGTGGTACATAGG + Intergenic
1097718631 12:62996282-62996304 ACTTCAGAGTATTAGTACATGGG + Intergenic
1098523646 12:71461787-71461809 ACTAGACAGTAGGAGGTCATTGG - Intronic
1098645132 12:72890612-72890634 ACTAGTGAGAAGTAGTAAAAGGG + Intergenic
1107945470 13:45414290-45414312 ACTAGAGAGCCGCAGTACATGGG + Intronic
1110663678 13:78090151-78090173 ACTAGAGAGTTATAGTATACTGG + Intergenic
1115617515 14:35110407-35110429 ACTACAGAGTGGTACTACATAGG - Intronic
1116785382 14:49282026-49282048 ATTTGAGATGAGTAGTACATTGG + Intergenic
1120826424 14:88960208-88960230 ACTAGGGAGAAGTAGTTTATGGG + Intergenic
1126606534 15:50483015-50483037 ATTAGAGAGTTTTAGTACATGGG - Intronic
1126830797 15:52602696-52602718 ACTCGGGTGGAGTAGTACATGGG - Intronic
1130581422 15:85140468-85140490 ACTAGAGGGAATTAGTAAATTGG + Intergenic
1130756582 15:86770781-86770803 ACCACAGAGGAGTAGTACACAGG + Intronic
1140599113 16:76453610-76453632 AATATAGAGGAGTAGTACAATGG - Intronic
1141058450 16:80841026-80841048 ACTAGTGACTAGAAATACATTGG + Intergenic
1149790576 17:59473249-59473271 TCAAGAGAGTAGAAGTATATAGG - Intergenic
1150563866 17:66320301-66320323 ACTACAGAGTACAAGTACAAAGG - Intronic
1151076998 17:71285364-71285386 ATTTGAGAGTAGGAGTACAATGG + Intergenic
1158607617 18:58909829-58909851 ACTAGCTAATAGTAGTAAATAGG + Intronic
1159410183 18:68063809-68063831 ACTAAATAGTAATAGTACATGGG - Intergenic
1160574552 18:79845064-79845086 ACTGCAGAGTAGTATTCCATGGG - Intergenic
928835904 2:35544713-35544735 AGTAGAGAGTTGTAGTGCCTGGG + Intergenic
929969445 2:46561439-46561461 GCTACAGAGTAGTCGTTCATCGG + Intronic
930930909 2:56881078-56881100 ACTGAAAAGTAGTAGTAAATAGG + Intergenic
937124087 2:119462174-119462196 TCTAGAGAGTAGGAGTCCACAGG + Intronic
937405886 2:121628740-121628762 AATAAAAAGTAGTAATACATAGG + Intronic
939847038 2:147260111-147260133 AGAAGAGAGTAGTCCTACATTGG + Intergenic
942179278 2:173364734-173364756 AATAAAGAGAAGTAGTACTTTGG - Intronic
942593823 2:177573493-177573515 ACTAGAGAGTAAAAGCACAGAGG - Intergenic
948100337 2:235367779-235367801 AGTAGTGAGGAGTAGAACATTGG - Intergenic
1169103721 20:2975747-2975769 ACTAGAGAGTAGGGGGACATGGG + Intronic
1172087752 20:32401297-32401319 ACTACACAGGAGTAGTACAAAGG - Intronic
1172327406 20:34047231-34047253 AATACAGAGCAGTAGTACCTGGG + Intronic
1177089641 21:16751532-16751554 AGTAGAGAGTAACAGTAGATAGG - Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
953862852 3:46560149-46560171 CCTAGAAGGTAGTAGTTCATGGG + Intronic
967105757 3:186253821-186253843 ACTAGGGAATAGTGGGACATTGG + Intronic
971087738 4:23298615-23298637 AGTAGTGCATAGTAGTACATGGG - Intergenic
973106420 4:46344244-46344266 ACTAGAGATTAGTGCTACAAAGG + Intronic
976415938 4:84774599-84774621 ACTAGTGAATAGTAGAATATTGG - Intronic
979756182 4:124342334-124342356 ACTAGAAAGTAGCTGTACTTGGG + Intergenic
981891416 4:149743121-149743143 AGTAGAAAGTAGTAGGAAATCGG - Intergenic
983953100 4:173665335-173665357 ACTATAAAATAGTAATACATTGG - Intergenic
984347909 4:178554641-178554663 ACTAGAGAGTTGTTGTTCAATGG + Intergenic
984448697 4:179871320-179871342 AATCTAGAGTTGTAGTACATGGG - Intergenic
988471329 5:31542055-31542077 ATTAAAGATGAGTAGTACATAGG + Intronic
994912934 5:105936526-105936548 TCTAGAGATTAGTAGTACTTGGG - Intergenic
996873952 5:128221192-128221214 ACTGGTGAGTAGTATTCCATTGG - Intergenic
997495414 5:134319937-134319959 GCTAGAGAGTAGTAGCAGAATGG + Intronic
997895540 5:137712786-137712808 ACTAGAGAGTGGTGGGACAGAGG - Intronic
999747275 5:154601947-154601969 ACTAGAGAGTTATTGTTCATGGG - Intergenic
1001843472 5:174901254-174901276 ACTAAAGAGTATTTGTGCATGGG + Intergenic
1011980175 6:93364710-93364732 AGTACACAGTAGTTGTACATAGG - Intronic
1012034104 6:94109553-94109575 ACTTAACAGAAGTAGTACATAGG + Intergenic
1012538516 6:100329447-100329469 AAAAGAGAGGACTAGTACATTGG + Intergenic
1018308581 6:162484619-162484641 TCAAGAGAGTAACAGTACATCGG + Intronic
1025932655 7:66009027-66009049 GCTAGAGAGGGGTAGGACATGGG + Intergenic
1028335838 7:89653549-89653571 ACAAGAGAGTAGTAATAATTGGG - Intergenic
1031437330 7:121749006-121749028 ACTAGCTATAAGTAGTACATGGG + Intergenic
1039660261 8:39453919-39453941 ACTATATAGTATTAATACATAGG + Intergenic
1041863693 8:62543594-62543616 CCTAGAGTGTAATAGTTCATGGG + Intronic
1048025317 8:130581316-130581338 ACTATAGAGTTATAGTACTTAGG - Intergenic
1052681484 9:31698760-31698782 ACTAGATAGTAGTATGAGATGGG + Intergenic
1058101162 9:100919022-100919044 CGCAGAGAGTAGTAGTAGATTGG - Intergenic
1192337649 X:70235452-70235474 AGTAGAGAGCAGGAGTACAGAGG + Intronic
1196206077 X:112941611-112941633 ACAAGAGGGCACTAGTACATAGG - Intergenic
1196432659 X:115643541-115643563 ACTATAGAGTAGAAATACATAGG + Intronic
1197358659 X:125469743-125469765 ACTACAGAGAAGTGGCACATAGG - Intergenic
1197966788 X:132072081-132072103 ACTACAGAGTAGTAGTGGAGTGG - Intergenic
1199048512 X:143206868-143206890 TGTAGAGATTAGGAGTACATAGG - Intergenic
1199623256 X:149717431-149717453 AGTAGAGAGTGGTAGCACCTGGG + Intergenic