ID: 1082843085

View in Genome Browser
Species Human (GRCh38)
Location 11:57705140-57705162
Sequence ATTCTGTGGGAAGAAGGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 351}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082843085 Original CRISPR ATTCTGTGGGAAGAAGGTGA AGG (reversed) Exonic
900618682 1:3577138-3577160 ACTCTCTCGGAAGAAGGGGAGGG - Intronic
900661605 1:3787211-3787233 TTTCCGTGGGAACAAGCTGAGGG - Exonic
901493706 1:9609467-9609489 CTTCTGTGGGAAGAAGGGCATGG + Intronic
902421404 1:16283377-16283399 ATTCTGTGGGGAGAATGTGGTGG + Intronic
904400713 1:30254697-30254719 ATGGTGTGGGGAGAAGGTTAGGG + Intergenic
904840282 1:33368060-33368082 ATTCTGTGGGCAGCCGGGGAAGG - Intronic
904865458 1:33575339-33575361 ATTCTGTGGGAAGTAGGAGGTGG + Intronic
905839898 1:41166938-41166960 ACTCAGTGGTAAGAAGTTGAAGG - Intronic
907918406 1:58891387-58891409 ATTCTGTTGGGAGAGGTTGAGGG - Intergenic
907980999 1:59480740-59480762 ATGATGTGGGAAGAAGGTGCTGG + Intronic
910857377 1:91709031-91709053 GTTTTGTGAGAAGAAGGGGAGGG - Intronic
910987968 1:93024953-93024975 ATTCTAAGGTAAGAAGGTTAAGG - Intergenic
911114594 1:94233681-94233703 ATACTGTTGGAAGAATGAGAAGG - Intronic
911791074 1:102015612-102015634 GTAATGTGGGAAGAAGCTGAAGG - Intergenic
912581392 1:110724188-110724210 ATCCTTTGGGAAGATGGTGCTGG - Intergenic
913216401 1:116624314-116624336 ATGCTGTGGGAAGTCAGTGAAGG - Intronic
913339254 1:117741489-117741511 AAAATGTGGGAAGGAGGTGAGGG - Intergenic
914418349 1:147505247-147505269 ATTCTGTGGGAGGATGGGGGAGG - Intergenic
915033504 1:152903765-152903787 ATTCTGTGAGAATTTGGTGAGGG - Intergenic
916269906 1:162929338-162929360 ATGCTGTGGGAACATGGTGATGG - Intergenic
916275645 1:162990555-162990577 ATTCTGTGAGAAAAAGAAGAAGG + Intergenic
918711010 1:187729997-187730019 ATTTTTTGGGAAGAATTTGATGG - Intergenic
919506745 1:198408313-198408335 ATCCTGTGGGAAGAAAAGGAAGG - Intergenic
919538866 1:198824310-198824332 GTGCTGTGGAAAGAAGGAGAAGG - Intergenic
919837518 1:201585290-201585312 ATTCTGTGAGAATACGATGATGG + Intergenic
920202489 1:204268153-204268175 ATTCTGTGAGGAGAAGGTGGAGG + Intronic
920563456 1:206955842-206955864 ATCTTGGGGGAAGAAGGGGAGGG - Intergenic
920608021 1:207409024-207409046 CTTCTGTGAGAAGGAGGTGGGGG - Intergenic
922247404 1:223813857-223813879 ATTTTGTGGGAGTAAGTTGAGGG - Intronic
923131541 1:231078936-231078958 ACACTGAGGCAAGAAGGTGAAGG - Intergenic
923651282 1:235876321-235876343 ATACTGTGGGAAGCAGGAGAGGG - Intronic
924054326 1:240110674-240110696 AATATGTGGGAAGAGCGTGAGGG + Intronic
924530997 1:244893857-244893879 ATTCTGTGGGAGAAATGTCATGG - Intergenic
1063979123 10:11439781-11439803 TTTCTGTTCGAGGAAGGTGAGGG - Intergenic
1065540998 10:26767529-26767551 ATTTTGGGGGAAGAAGGTCGAGG + Intronic
1067183707 10:44009449-44009471 TTTCTAAGGGCAGAAGGTGAAGG - Intergenic
1069152335 10:64979324-64979346 AAACGGAGGGAAGAAGGTGAAGG - Intergenic
1070209542 10:74301763-74301785 ATTCTTTTAGAAGAAGATGAGGG - Intronic
1070351867 10:75600216-75600238 ATGCTGTGGAAAGAAGATGCAGG - Intronic
1070386053 10:75925590-75925612 ATTGTGGAGGAAGAAGGTGATGG + Intronic
1071840241 10:89462986-89463008 AGTCTGTTGGAAGAGGGTGCTGG - Intronic
1072038773 10:91588456-91588478 ATTCTGGGGGAAGAATAAGAGGG - Intergenic
1072424370 10:95317186-95317208 GGTCTTTGGAAAGAAGGTGAAGG + Intronic
1072490209 10:95898011-95898033 AGTCTGTGGGTGGAAAGTGAAGG + Intronic
1072758554 10:98037310-98037332 ATTGGGTGGGAAGAATATGAAGG - Intergenic
1073133957 10:101209252-101209274 ACTCAGTGGGAAGAAGGAAAGGG - Intergenic
1073207801 10:101777843-101777865 AATCTGTTGGGAGGAGGTGAAGG - Intronic
1073321900 10:102620705-102620727 ATGCTGGGGGAAGGAGGTGCAGG - Intronic
1073938048 10:108658545-108658567 ATTTTTTGGAAACAAGGTGAAGG + Intergenic
1074219954 10:111426792-111426814 ATGCTGGGTGAAGAGGGTGAGGG - Intergenic
1074706479 10:116137478-116137500 ATTAATTGGGAAGCAGGTGAAGG - Intronic
1075632951 10:124012105-124012127 ATTCTCTGGAGAGAAGGAGATGG - Intronic
1075776251 10:124990826-124990848 AGGATGTGGGAAGAAGCTGACGG + Intronic
1075922045 10:126221778-126221800 ATTCTTTGGGGAGAATGAGAAGG - Intronic
1077409346 11:2396172-2396194 ATTCCGGGTGAAGAAGGTGGAGG + Intronic
1077895471 11:6450255-6450277 ATTCTGTGATAGGAAGGTGCAGG - Intronic
1078913224 11:15752817-15752839 ATTTGGAGGGAAGAAGGGGAAGG - Intergenic
1079016044 11:16869654-16869676 AATCTAGGGGATGAAGGTGAAGG + Intronic
1079410253 11:20180799-20180821 TTGCAGTGGGAAGAAAGTGATGG + Intergenic
1079657713 11:23003167-23003189 ATTTTGTGGGAAGAACCTGGTGG - Intergenic
1079908059 11:26273676-26273698 ATTCTGTCGGGGGAAGGTAAAGG + Intergenic
1080805992 11:35654412-35654434 TTTCTGTGGGAAGAAGTTGAGGG + Intergenic
1081088425 11:38830268-38830290 ATTGTCTTGGAAAAAGGTGAAGG + Intergenic
1081098151 11:38966861-38966883 ATGCTGTGGAAAGAATTTGAGGG + Intergenic
1082788018 11:57327902-57327924 GTTCTGTGGGAAATAGCTGAAGG - Intronic
1082843085 11:57705140-57705162 ATTCTGTGGGAAGAAGGTGAAGG - Exonic
1083056910 11:59830612-59830634 ATTTCTTGGGATGAAGGTGATGG + Intronic
1084617592 11:70246710-70246732 GATCTTTGGGAAGAAGGTAAGGG + Intergenic
1084627423 11:70319149-70319171 ATTCTGGCGGAAGCAAGTGAAGG - Intronic
1084848981 11:71923141-71923163 CTTCTGTGGGAACAACCTGAGGG + Intronic
1085245478 11:75097589-75097611 GTTTTGTGGAAAGAATGTGAGGG + Intergenic
1085840963 11:80011473-80011495 ATACAGTGGGAAAGAGGTGAAGG + Intergenic
1086432763 11:86751377-86751399 ACTATGTGGCAAGAAGTTGAGGG - Intergenic
1087091592 11:94278924-94278946 TTTGTGTGGGTGGAAGGTGAGGG + Intergenic
1087701035 11:101436585-101436607 ATTTTGTGGAAAGAAGATGCAGG + Intergenic
1088409126 11:109514004-109514026 ATGCTGTTGGAAGAAAGGGAAGG - Intergenic
1089927228 11:122271300-122271322 ATTCAGTGGGAAGAATGAGGCGG + Intergenic
1090056292 11:123427917-123427939 AGTGTGTGGGAAGAGGGTGCTGG + Intergenic
1093138436 12:15479020-15479042 ATTCAGTGCGGTGAAGGTGAAGG - Intronic
1093176866 12:15922642-15922664 ATCCTGTGGAAAGAATGTCAGGG + Intronic
1094105713 12:26809374-26809396 ATTCTGTGGAATGAAACTGAAGG + Intronic
1098042401 12:66365434-66365456 ATTTTTTGGGAGGGAGGTGAGGG - Intronic
1098681767 12:73365256-73365278 ACTCTGTGGGATGGGGGTGAGGG + Intergenic
1101640969 12:106585559-106585581 ATTCTCTGGAAGGGAGGTGAGGG - Intronic
1102395954 12:112585942-112585964 ATTCTGTGGGACCAAGGAGGTGG + Intronic
1102800011 12:115723913-115723935 ATGTTGTGGGAAGAAGATGATGG + Intergenic
1103041735 12:117701446-117701468 ATGCTTTGGGAAGATGCTGAAGG - Intronic
1103187786 12:118975998-118976020 CTTCTGCAGGAAGAAGGTGGAGG + Intergenic
1103799577 12:123528926-123528948 GTGCTGAGGGAAGAACGTGAAGG - Intronic
1103976479 12:124705885-124705907 AGGCTGTGGGAAGATGGAGAGGG + Intergenic
1103995820 12:124829355-124829377 ATTCTGTGGGGAGAACGGGGCGG - Intronic
1104120663 12:125796149-125796171 ATTATTTGAGAAGAAGCTGAAGG + Intergenic
1104179468 12:126364648-126364670 ATTCCATGGGCAGAAGGAGATGG - Intergenic
1106120614 13:26857348-26857370 AAACAGTGGGAAGAGGGTGAGGG - Intergenic
1106317764 13:28610009-28610031 GTTCTGTGGGAGGATGGTGGTGG - Intergenic
1106580993 13:31018225-31018247 ATTCAGTGCCAAGAAGGGGAAGG + Intergenic
1106695336 13:32166741-32166763 AGTCTGTGGGTAGTAGGTGAGGG - Intronic
1107518184 13:41152327-41152349 ATTTGGTGGGAAGAAGGTTAAGG + Intergenic
1108789907 13:53956719-53956741 ATTTTGGGGAAAGAAGATGAAGG - Intergenic
1109704801 13:66076482-66076504 AATCTGAGGGCAGAAGGTGATGG - Intergenic
1110528170 13:76564104-76564126 CTTGTTTGGGAAGAAGGGGAAGG - Intergenic
1111055907 13:82950696-82950718 ATTGTGGTGGAAGATGGTGAAGG - Intergenic
1112009242 13:95280097-95280119 ATACTGTGAGAAGTTGGTGACGG - Intronic
1112397788 13:99049255-99049277 ATTCTGAGGTTGGAAGGTGAGGG - Intronic
1113028690 13:105970217-105970239 CTTTTGTGGGAGGAAGGAGAGGG - Intergenic
1113968056 13:114165831-114165853 ATTCTGGGGGAAGGAGGAGGAGG + Intergenic
1116176007 14:41471210-41471232 ATTCTATGGGAAGTAGATGAAGG - Intergenic
1117609455 14:57467097-57467119 TTTCTGTGGTAAGAAAGGGAGGG + Intergenic
1118357790 14:65029606-65029628 ATTCTGTGAGGATAAGGTGGAGG + Intronic
1119920304 14:78440335-78440357 TTCCTCAGGGAAGAAGGTGATGG - Intronic
1120266297 14:82254756-82254778 ATTCTGTGGGCTGAAGGTCTGGG - Intergenic
1121031969 14:90665962-90665984 AGTCTGTGGGTATAAGGTGATGG - Intronic
1121203699 14:92142809-92142831 TTTCTTTGGGATGAAAGTGAGGG + Intronic
1121418774 14:93797819-93797841 AAGCTGTGGGAGGAAGGAGATGG + Intergenic
1121633751 14:95439877-95439899 CTTCTTTGGGAAGTGGGTGAGGG + Intronic
1121775185 14:96585682-96585704 ATCTTGGGGGAAGAAGGAGAAGG + Intergenic
1122032144 14:98920014-98920036 ATCCAGTGACAAGAAGGTGATGG - Intergenic
1122416301 14:101551237-101551259 ATTCTGTGGGCAGAAGGGTTGGG - Intergenic
1123494481 15:20812001-20812023 ATTTTGTGGGAAGGTGGGGATGG + Intergenic
1123550977 15:21381094-21381116 ATTTTGTGGGAAGGTGGGGATGG + Intergenic
1124654917 15:31500077-31500099 ATTCTGTGGTCAGAAGGTGATGG - Intronic
1124786789 15:32688988-32689010 ACTCTGTGGGAAGAAGTTTTGGG + Intronic
1125360255 15:38857397-38857419 ATACTGAGTGAAGAAGGTGAGGG + Intergenic
1125771485 15:42169819-42169841 AGTCTGTGGGCAGCAGGTCAGGG + Exonic
1126230017 15:46313329-46313351 ATTCTGTAATAAGAAAGTGAGGG + Intergenic
1126913014 15:53435040-53435062 TGTCTTTGGGAAGAAGGTTAAGG + Intergenic
1127856768 15:62960014-62960036 ATACTGTGGGGAGAGGGGGATGG + Intergenic
1130061371 15:80572497-80572519 ATTCTGTGGGTAGGAAGAGAGGG - Intronic
1130066166 15:80606685-80606707 ATTTTGTGGGATGGAGGTGGTGG + Intergenic
1130246858 15:82259724-82259746 ATTCTGTGTAAAGAATGTCAGGG + Intronic
1131474209 15:92722474-92722496 AAAGGGTGGGAAGAAGGTGAGGG - Intronic
1132268597 15:100502830-100502852 TTGCTGTGGGAACAAGATGATGG + Intronic
1132306377 15:100817114-100817136 ATTCTGTGGGGTGTAGGTTAAGG - Intergenic
1202959319 15_KI270727v1_random:108337-108359 ATTTTGTGGGAAGGTGGGGATGG + Intergenic
1132576665 16:667412-667434 ACTCTGTGGGTAGACGGTGCAGG - Exonic
1132626683 16:894728-894750 ACACGGTGGGAAGAGGGTGAGGG + Intronic
1133720153 16:8487204-8487226 ACTGTTTTGGAAGAAGGTGATGG + Intergenic
1134319775 16:13152034-13152056 ATTGTGTGAGAAGAAGATCAGGG + Intronic
1134475897 16:14573647-14573669 ATGTTGTGGGAGGAACGTGATGG + Intronic
1136240327 16:28939360-28939382 ATTGTGTGGGAAGGAAGGGAAGG + Intergenic
1136544151 16:30946635-30946657 CTTATGTGGGAAGCAGGTGGAGG + Intronic
1137618583 16:49860811-49860833 ATTCTCTGGGGAAAAGCTGAAGG - Intergenic
1137645316 16:50068101-50068123 ATGCTGTGGGAGGAAGGGAAGGG - Intronic
1137999122 16:53255660-53255682 ATTATGGAGGAAGAAGATGAAGG + Exonic
1138065876 16:53940895-53940917 ATTCTGGGGGTAGGTGGTGATGG - Intronic
1138143347 16:54587035-54587057 ACTGTGTGGGAAGAAGGAGTGGG + Intergenic
1139205980 16:65028749-65028771 ATTCTGTAGGAAGATGTTAATGG - Intronic
1139970178 16:70769424-70769446 CCGCTGTGGGAAGAAGGTGGTGG + Intronic
1142020784 16:87780899-87780921 AGCCTGTGGGGAGAGGGTGAAGG - Intergenic
1142805645 17:2369837-2369859 AGACTCTGGGAAGAAGGGGAGGG - Intronic
1143189224 17:5029568-5029590 ACTCTGAAGGAAGAAGATGATGG - Intergenic
1143618123 17:8065453-8065475 TCTGTGTGGGAAGAAGGTCAGGG + Intergenic
1145932720 17:28697600-28697622 TTCCTGTGGGAAGAAGGTAAAGG - Exonic
1147539516 17:41345480-41345502 AGTGTTTGGGAAGAAGGTGGTGG - Intergenic
1147885016 17:43678589-43678611 ATTCTGGGGGTTGAGGGTGAGGG + Intergenic
1149156309 17:53633838-53633860 ATTCATTGGGAAGAAGTTGTTGG - Intergenic
1149579243 17:57736907-57736929 ATTCTGTGTGCAAGAGGTGAAGG - Intergenic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1153181869 18:2444443-2444465 ATGCTATGGGAAGATGGTGAAGG + Intergenic
1153193871 18:2571725-2571747 GTTCTGGAGGAAGAAAGTGATGG + Intronic
1155159454 18:23183910-23183932 TTTCTGGGGTTAGAAGGTGAGGG + Intronic
1155916025 18:31557787-31557809 ATTCTGCAGGAAGAGGGTGGGGG + Intergenic
1156309218 18:35907418-35907440 GTTCTGTCTGAAGAAAGTGAAGG + Intergenic
1156361361 18:36387140-36387162 AGACTGTGGGCAGAAGGTGTTGG + Intronic
1158152830 18:54391584-54391606 ATTCTGTGGGCAGAAGGAAGGGG + Intergenic
1158392666 18:57056303-57056325 ATGCTGTGTGCAGAAGGAGAGGG + Intergenic
1158709271 18:59822940-59822962 AGTCTGGGGTAAGAGGGTGAAGG + Intergenic
1162783238 19:13018205-13018227 ATTCTGTGCCAAGAGGGTAAGGG + Intronic
1162839052 19:13342143-13342165 ATTCCCAGGGAAGAAGGTGGTGG + Intronic
1165452024 19:35889392-35889414 AAGATGTGGGAAGAAGGTCAAGG + Intronic
1165908987 19:39212365-39212387 ATTCTGAAGGAAGCCGGTGAAGG + Intergenic
1165963832 19:39557830-39557852 AGGCTGTGGGGAGAAGGTAACGG + Intergenic
1165969696 19:39616717-39616739 AAAGTGTGGGAAGAAGGTGAGGG - Intergenic
1166976519 19:46608177-46608199 ACTCTGGGGGAAGAAGGGGGAGG - Exonic
1167515481 19:49920981-49921003 TTTCTCTGGGAACCAGGTGAAGG + Intronic
1167677666 19:50897562-50897584 ATTCTGTGGGAGGGTGGAGAAGG - Intergenic
1168395339 19:56042748-56042770 ATTTTGGGGGAAGAATGGGAGGG - Intronic
925224065 2:2167375-2167397 ATTTGGTTTGAAGAAGGTGAAGG - Intronic
925510024 2:4615166-4615188 ATAATTTGGGAAGAAGATGATGG - Intergenic
925565546 2:5250295-5250317 ATTCTGTGCAAAGACAGTGAAGG - Intergenic
926344847 2:11935839-11935861 TTTCTGTGGGAAGATACTGATGG + Intergenic
927167455 2:20338521-20338543 ATTCTGTGGGAATTAAGAGAAGG - Intronic
927518986 2:23688036-23688058 ATGCTCAGGGAAGAGGGTGAAGG - Intronic
928048602 2:27965453-27965475 ATTATTTGGGAAAAAGCTGATGG - Intronic
928816692 2:35304669-35304691 TTTCTCTGGGAAGCATGTGAAGG + Intergenic
929335805 2:40743755-40743777 ATGCTGTTGGAAGAAGGAGAGGG + Intergenic
929570185 2:43018059-43018081 ATTCTTTGAGATGAGGGTGAAGG + Intergenic
929780467 2:44953856-44953878 ATTCTGAGGGAAGAGGGAGTAGG + Intergenic
931092558 2:58901438-58901460 GTTCTGGTGGAAGAAGGTGGAGG + Intergenic
931696493 2:64874539-64874561 ATACTATTGGAAGCAGGTGAGGG + Intergenic
931735596 2:65190611-65190633 TTTCTGTGGGAAGCAAGTGTTGG - Intergenic
932633719 2:73369687-73369709 ATTAGGTGGGCAGAAAGTGAAGG - Intergenic
932748542 2:74355879-74355901 ATTCTGGGAGAAGAAGGGGGAGG + Intronic
933264739 2:80169606-80169628 ACTCTGTGGGTAGGAGGTGTTGG + Intronic
933291739 2:80445423-80445445 ATTTTGAGGGAATAAGGTGGTGG - Intronic
933498543 2:83082838-83082860 ATTCTCTAAGAAGAAGGTAAAGG - Intergenic
933866132 2:86519418-86519440 TTTCTGTGGGAAGAAACTGGAGG + Intronic
934982156 2:98851559-98851581 CTGCTATGGGAAGAAAGTGAGGG - Intronic
935855680 2:107270350-107270372 AGTCTGAGGGAAGAGGGAGAAGG + Intergenic
936468082 2:112771834-112771856 ACTCAGTGGGAGGAAGGTTAGGG + Intergenic
937033535 2:118761827-118761849 GTTCTGTGGGAAGCTGGGGAGGG + Intergenic
937301954 2:120848051-120848073 AAGCTGTGGGAAGAGGGAGAAGG + Intronic
938211498 2:129469309-129469331 CTTTTGTGGGGAGAAGGGGATGG + Intergenic
942009352 2:171743545-171743567 TCTGTGTGGGAAGAAGATGAAGG - Intronic
942701258 2:178713548-178713570 AATCAGTGGGCAGAATGTGATGG + Intronic
943181644 2:184551450-184551472 AATCTGTGGGCTGAAGGAGATGG + Intergenic
943246107 2:185452486-185452508 ATTCTGTGGGAGGAACCTGGTGG - Intergenic
945797132 2:214378752-214378774 ATCCTGTGCCAAGAATGTGAAGG + Intronic
945815986 2:214605509-214605531 ATTCTGTGGGAAAAAAATTAAGG - Intergenic
945876978 2:215288035-215288057 ATTGAGTGGGAAAAAGGAGAAGG + Intergenic
946968774 2:225068501-225068523 ATGCTGTGGGATGAACCTGATGG + Intergenic
948107583 2:235427832-235427854 ATTCTGAGGGAGCAAGCTGACGG - Intergenic
949012562 2:241689528-241689550 ATGCTGGGGGCAGAAGGGGAGGG - Intergenic
1169169302 20:3451576-3451598 GTTCTTTGGGCTGAAGGTGATGG - Intergenic
1169341281 20:4798258-4798280 ATCCTGGGGGAAGATGGTTATGG - Intronic
1169953164 20:11070857-11070879 ATTATGTGGGAAGAGAGAGAAGG - Intergenic
1170085917 20:12531391-12531413 AACTTGAGGGAAGAAGGTGATGG + Intergenic
1170638824 20:18133874-18133896 TTTGTTTGGGAAGAAGGTGGAGG - Intergenic
1171961713 20:31499357-31499379 ATACTGTGGGATGGAGGGGATGG + Intergenic
1173743097 20:45416328-45416350 CTTCAGCGGGAAGGAGGTGAGGG + Exonic
1173950055 20:46985159-46985181 ATCTTGTTGGAAGAAGGTGATGG + Intronic
1174103039 20:48141723-48141745 AGTTTGTGGGAAGAGGGTTAGGG - Intergenic
1174216500 20:48920616-48920638 ATGGTGTAGGAAGGAGGTGAAGG - Intergenic
1174982024 20:55407546-55407568 ATTTTTTGGGAAGAAAGTAAGGG - Intergenic
1175914849 20:62421051-62421073 AATCTGTGGGAGGAGGGGGAAGG - Intronic
1176884436 21:14237526-14237548 GTTCTGTGGGTAGAAGGTGGAGG - Intergenic
1178440294 21:32593068-32593090 ATCCTCTGGGAAGAAGGACAGGG - Intronic
1178761086 21:35403531-35403553 ACTCTGTGGGAAGAAATTGCCGG - Intronic
1178810792 21:35879158-35879180 AGTCTGTGTGAAGAAGATGTGGG - Intronic
1180817744 22:18802687-18802709 ATGCTGTGGGAAGTCAGTGAAGG - Intergenic
1181203960 22:21237140-21237162 ATGCTGTGGGAAGTCAGTGAAGG - Intergenic
1181332116 22:22100876-22100898 ATTCTGGAAGAAGAGGGTGAAGG + Intergenic
1181436857 22:22916208-22916230 ATTCTATGGGGATAAGGTGATGG - Intergenic
1182335408 22:29580594-29580616 GTTCTGTGGGAAAGAGATGATGG - Intronic
1182584380 22:31335564-31335586 ATTCAGTGGGAAGTAGGGGGTGG + Intronic
1184336742 22:43858311-43858333 CTTCTGGAGGAAGAAGGAGATGG - Intronic
1184382575 22:44155179-44155201 ATTCTGTGGACAGAAGCTCAGGG - Intronic
1203222961 22_KI270731v1_random:58275-58297 ATGCTGTGGGAAGTCAGTGAAGG + Intergenic
1203267868 22_KI270734v1_random:28538-28560 ATGCTGTGGGAAGTCAGTGAAGG - Intergenic
949260786 3:2100063-2100085 ATTCGGTGCGAAGAAGCTGGCGG + Intronic
949459678 3:4276955-4276977 GTTCTGAGGGAAGATGGGGATGG + Intronic
950041997 3:9925744-9925766 AAGCTTTGGGAAGGAGGTGAGGG - Intronic
950157308 3:10731516-10731538 ATTTTTTGGGAAGAAGGTAGTGG + Intergenic
950711437 3:14815777-14815799 ACTCTGTGGCAAAAAGGGGATGG + Intergenic
950872626 3:16242804-16242826 ATTCTGTAAGAAGGAGGTGGTGG + Intergenic
951622987 3:24626358-24626380 ACTCTCTGGGAAGATGATGAGGG + Intergenic
952552074 3:34490221-34490243 ATTTTGGGGGAGGGAGGTGAGGG + Intergenic
952906740 3:38144088-38144110 ATTCTGTGTGACGATGGAGATGG + Intergenic
953023335 3:39129990-39130012 AATCAGTGGGAAGGAAGTGAAGG + Intronic
953778549 3:45844323-45844345 AATCTGAGGGAAGAAGTGGAGGG + Intronic
954357069 3:50090721-50090743 ATTCTCTGGAAGGAAGCTGAAGG + Intronic
954869781 3:53758982-53759004 AGTATGTGGGAAGAATGGGAGGG + Intronic
956876875 3:73472366-73472388 ATTCTGTGGCAAGAGGCTCAGGG + Intronic
956990700 3:74759883-74759905 AAAGGGTGGGAAGAAGGTGAGGG + Intergenic
958792752 3:98670728-98670750 ATTCTGTCGAAAGAACCTGAGGG - Intergenic
959155209 3:102658665-102658687 AATCTCTGGGCAGAAGTTGAGGG + Intergenic
959172396 3:102859296-102859318 ATTCCATGGGAAGAAGCTGGTGG - Intergenic
959378301 3:105611639-105611661 ATTCGGTGGGCAGAAGGCTAGGG + Intergenic
960554040 3:119007898-119007920 TTTCTGAGGGAAGAAGGAGGAGG - Intronic
960844698 3:121994867-121994889 AGTTTGTGGGAAGAAGGCAAGGG + Intronic
961469924 3:127105232-127105254 ACTCTGAGGGATGAAGGTGGAGG + Intergenic
962063015 3:131951526-131951548 AGACTGTGGGGAGAGGGTGAAGG - Intronic
963090450 3:141478626-141478648 ACTCTGGGGAAAGAGGGTGAGGG + Intergenic
963257216 3:143157561-143157583 ATTCTGGAGGTAGATGGTGATGG + Intergenic
963346052 3:144097617-144097639 CTTTTCTGGGAAGAAGGTCAGGG - Intergenic
964606242 3:158563003-158563025 ATTCTGGGGTAACAAGGTAAAGG - Intergenic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
966975941 3:185083290-185083312 ATTCTGTGGGAATGTGGTGCCGG + Exonic
967222164 3:187256566-187256588 ATCCTGGGAGAAGAAGGTGAAGG + Intronic
967628726 3:191717734-191717756 ATACTGTGGGAACAAGAAGAAGG - Intergenic
967915154 3:194573063-194573085 ATTCAGTGGGATGGAGGTGGAGG - Intergenic
967979194 3:195055347-195055369 ATTGTGTAGGCAAAAGGTGAAGG - Intergenic
970208059 4:13675956-13675978 AGAGGGTGGGAAGAAGGTGAGGG - Intergenic
970357536 4:15270355-15270377 ATGCTGTGGGAGGAACCTGATGG + Intergenic
971798701 4:31260428-31260450 TCTCTGTGGGCAGAAGGTAATGG + Intergenic
971836237 4:31767124-31767146 ATTCAGTGGAAAGAAGGTTGGGG - Intergenic
972873644 4:43330743-43330765 ATACAGTGGGAACAATGTGAAGG + Intergenic
973650992 4:52997105-52997127 AGTCTGGGGGAATAAGGTCATGG - Intronic
973934611 4:55830631-55830653 ATTTTGTGGGAACAAAATGAGGG - Intergenic
975040954 4:69743853-69743875 AGCCTGTGGGAACAAGGTGGGGG + Intronic
976205358 4:82618849-82618871 ATTCTCTGGGAAGTAGATGCTGG + Intergenic
976302747 4:83530672-83530694 ATTGTGTGGGAATGACGTGAAGG + Intergenic
978656163 4:111067905-111067927 ATTCTGCGGGGAGAGGGTTATGG + Intergenic
980669562 4:135986917-135986939 ATTCTGTGGGAAAAGGGAAAAGG - Intergenic
981550229 4:145936310-145936332 ATTTTGTGCGAGGAAGGAGAAGG - Intronic
981785092 4:148468514-148468536 ATCTTGTGGAAAGGAGGTGAAGG + Intergenic
985512352 5:319755-319777 AACCTGTGGGTAGAATGTGATGG - Intronic
986356658 5:6935408-6935430 GTTCTGGGGAAACAAGGTGAAGG - Intergenic
987798622 5:22664335-22664357 ACTATCTAGGAAGAAGGTGAAGG + Intronic
988886172 5:35560278-35560300 ATGTTGTGGGAAGAACCTGATGG - Intergenic
989092950 5:37753703-37753725 ATTTTTTGGGAAGCAGGTGTGGG - Intergenic
990149924 5:52805172-52805194 ATTAAGTGGGAAGATGGGGAGGG + Intronic
990458131 5:56008569-56008591 TTTGTGAGGGAAGAAGATGAGGG + Intergenic
991060987 5:62375855-62375877 ATTGTATGGGGATAAGGTGAGGG - Intronic
991103146 5:62815592-62815614 ATTTTGTGGGAAATAAGTGATGG + Intergenic
991165091 5:63557350-63557372 ATTATGTGGCAAGAAGTTCAAGG + Intergenic
991319717 5:65358362-65358384 ATTGAGTGGGGAAAAGGTGAAGG + Intronic
992442386 5:76808338-76808360 AATCTCTGGGAAGAAGGGTAGGG - Intergenic
992889451 5:81190316-81190338 GTTCTGAGGGGAGAAGGAGAGGG - Intronic
995403380 5:111766554-111766576 AGTATGTGGGAAGCAGCTGAAGG - Intronic
996507689 5:124286681-124286703 AATAGGTGGCAAGAAGGTGAGGG + Intergenic
996642403 5:125771997-125772019 GTTGAGTGGGTAGAAGGTGAGGG + Intergenic
997061193 5:130505185-130505207 ATTTGGTGGAAAGAAGGGGAAGG + Intergenic
998222360 5:140295874-140295896 ATTCTGTGTGAAGATGAGGAAGG + Intronic
998312481 5:141149190-141149212 TTGCTGTGAGAAGACGGTGAAGG + Intronic
998673637 5:144382253-144382275 AGCATGTGGGAAGAGGGTGAAGG + Intronic
999102721 5:149039942-149039964 AGTGTGTGGGAGGGAGGTGAAGG + Intronic
999822036 5:155237975-155237997 ACTGTGTGGGAGGAAGTTGAAGG + Intergenic
1000162235 5:158609704-158609726 AGTATGGGGGAAGAAGGTGGGGG - Intergenic
1000381297 5:160632073-160632095 GTTCTGTGGGAAGAGAGGGAGGG - Intronic
1000813582 5:165891921-165891943 TTTTTGTGGGATGAAAGTGAAGG + Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002876838 6:1218033-1218055 ACTCTGTGGAACCAAGGTGAAGG + Intergenic
1004244495 6:13960116-13960138 AGTCATTGGGAAGAAGGTGAAGG + Intronic
1004319923 6:14624353-14624375 ATGCGGTGGGAAGCAGGAGAAGG + Intergenic
1004996404 6:21198001-21198023 AATCTGTGGAGAGAAGGGGAGGG - Exonic
1005176264 6:23048097-23048119 ATGCAGAGGGAAGTAGGTGATGG - Intergenic
1005964739 6:30719310-30719332 AATCTATGGGAAGAAGCAGATGG + Intergenic
1006268595 6:32946333-32946355 ATTTTTTGGGAAGGTGGTGAAGG + Intronic
1006602439 6:35235061-35235083 ATTCGGTGGGAAGACTGAGAAGG + Intronic
1007881745 6:45175923-45175945 AATCTTTGGGAAGAAGGTGAAGG + Intronic
1008645147 6:53506184-53506206 ATTCTCAGGGATGAAGGTGGGGG - Intronic
1008910990 6:56733065-56733087 TTTCTGTGAGAAGAATGTGTGGG + Intronic
1013963918 6:115932877-115932899 ATATTGTGGGTAGAAGCTGAGGG + Exonic
1016017523 6:139201126-139201148 ATTTGGTGGCAAGAAGTTGAAGG - Intergenic
1017125365 6:151059573-151059595 ATACTGTGGGAAGGACCTGATGG - Intronic
1018102037 6:160448814-160448836 AGTCTCTGGCAAGAAAGTGATGG - Intronic
1018324532 6:162650840-162650862 ATTCTGTGGGAGGAAGGATGAGG + Intronic
1019407550 7:891635-891657 GTTCTGTGGGAAGAAACTGACGG - Intronic
1019847136 7:3515069-3515091 ATTCTGCGGGTAGAAGGAGCAGG + Intronic
1020267058 7:6567928-6567950 AGTGTGTGGGGGGAAGGTGACGG + Intergenic
1020605105 7:10327243-10327265 TTTCTGTGGCAAGGGGGTGAAGG - Intergenic
1020869428 7:13608464-13608486 ATGCTGTGGGAGGAACCTGATGG + Intergenic
1020905530 7:14059925-14059947 CTTTTGTGGGTAGAAGGAGATGG + Intergenic
1021310541 7:19090575-19090597 ATTGGGTCGGAAGAAGGTGTAGG - Intronic
1021398965 7:20187485-20187507 AAGCTGTGGGAAGAGGGAGAAGG - Intronic
1022053526 7:26704284-26704306 AGTCTCTGGGAGGGAGGTGATGG - Intronic
1022274545 7:28842422-28842444 AATCTGTGGGAAGAAGGTTGTGG - Intergenic
1022803130 7:33794545-33794567 AATCTGTGGAAAGAAAGTAAAGG + Intergenic
1022879023 7:34566590-34566612 ATGCTGTGGAAATACGGTGAGGG - Intergenic
1024481183 7:49864969-49864991 CTCCTGTGGGAAGAATGGGAGGG + Intronic
1028248364 7:88510462-88510484 AAAGGGTGGGAAGAAGGTGAGGG - Intergenic
1028818136 7:95173034-95173056 ATACTGTGAGATGAAGGTCAAGG - Intronic
1029920274 7:104255011-104255033 ATTCTGTGGTAAGAAAGGAAGGG + Intergenic
1035763169 8:2084982-2085004 ATTCTGTTGGAAGAGGGGGAAGG - Intronic
1036145033 8:6246996-6247018 ATCATGTGGGAAGAAGGAAAAGG - Intergenic
1036406190 8:8457232-8457254 GTTCTGTGGACAGATGGTGATGG - Intergenic
1037717148 8:21410188-21410210 ATTCTGTGGGCTGGAGGTCATGG - Intergenic
1037814868 8:22106834-22106856 TCTCTGTGGGGAGAAAGTGATGG - Intergenic
1038280032 8:26155742-26155764 AATATGTGGGAAGAAGGAGATGG + Intergenic
1038546759 8:28431577-28431599 TTTCTGGGGGAAGAAGGTGGGGG - Intronic
1039163059 8:34644139-34644161 ATTTTGGGGGAAGGTGGTGAAGG - Intergenic
1040436682 8:47398163-47398185 AGTCTCTGGGAAGAAAGGGAGGG + Intronic
1041596256 8:59656809-59656831 AATCTATGGGAAGAAAGAGAAGG + Intergenic
1041632738 8:60106240-60106262 ATAGTGAGGGAAGAAGTTGATGG + Intergenic
1042292068 8:67179096-67179118 ATTATCTGGTAAGAAGGTGCAGG + Intronic
1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG + Intronic
1045507372 8:102788313-102788335 ATTCTGTGGGAGGAAGCTTGAGG + Intergenic
1047657769 8:126997366-126997388 AAACGGTGGGAAGTAGGTGAGGG - Intergenic
1048144734 8:131830188-131830210 AATGTGGGGAAAGAAGGTGAAGG + Intergenic
1049355338 8:142184968-142184990 TTGCTGTGGGCAGAGGGTGAGGG - Intergenic
1049655897 8:143797135-143797157 ATCCTGGAGGCAGAAGGTGAGGG + Intronic
1050484702 9:6121877-6121899 ATTCTTTGGGAAGTGGATGACGG - Intergenic
1050518716 9:6474105-6474127 ATTGTGAGGGGACAAGGTGAGGG + Intronic
1051277390 9:15409727-15409749 AAAGAGTGGGAAGAAGGTGAGGG - Intergenic
1052441345 9:28499727-28499749 TTTCAGTGGGAATAAGATGAAGG - Intronic
1052739528 9:32380220-32380242 ATTCTGGGGGATGGAGGTGTTGG - Intergenic
1052889643 9:33686544-33686566 ATTCTGGGGTAAGTAGGAGATGG - Intergenic
1056621257 9:88216822-88216844 TGTCTGTAGGAAGATGGTGAAGG - Intergenic
1057993553 9:99798410-99798432 ATTCTTTGGGAACACGGAGAAGG - Intergenic
1058131465 9:101258630-101258652 ATTCTGTGAATAGAAGGTCATGG - Intronic
1059722652 9:116976186-116976208 GGTCTATGGGAAGAAGGAGAGGG + Exonic
1060819437 9:126652772-126652794 AGCCTGTGGGAACAAGGGGATGG + Intronic
1185837542 X:3359445-3359467 ATGCTAAGGGAAGAAGGTGCCGG - Intergenic
1186075539 X:5874549-5874571 ATGCAGAGAGAAGAAGGTGAGGG - Intronic
1186172930 X:6896639-6896661 ATACTGCAGGAGGAAGGTGAAGG - Intergenic
1187400625 X:18956797-18956819 ATTGTGTTGGAAGAAGATGGGGG + Intronic
1190098466 X:47501979-47502001 AATCTGTGTGAAGTAGGTGAAGG - Intergenic
1190614215 X:52213365-52213387 TTTCTGTGGGAGGCAGGAGATGG - Intergenic
1195970693 X:110470034-110470056 TTTCTGAGGAAAGAAGGTGGTGG - Intergenic
1195990127 X:110674201-110674223 ATGCTGTGGGAAGCAGGAGCTGG - Intronic
1196129740 X:112142485-112142507 ATTATTGGGGAAGAAGGAGATGG - Intergenic
1197169335 X:123413756-123413778 ATACTGAGGGATGAAAGTGAAGG + Intronic
1199572555 X:149282000-149282022 ATTCTGTGGCAATAAAGTGGTGG + Intergenic
1201141058 Y:11028264-11028286 ATGCTGTGGAAAGAAAGTAATGG - Intergenic
1201141070 Y:11029198-11029220 ATCCTGTGGAAAGAAAGTAATGG - Intergenic
1201721969 Y:17108893-17108915 ATGTTGAGGGAGGAAGGTGATGG + Intergenic