ID: 1082843786

View in Genome Browser
Species Human (GRCh38)
Location 11:57711338-57711360
Sequence CGAGTTCCAAACTCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082843784_1082843786 1 Left 1082843784 11:57711314-57711336 CCAAAGATATTAAATCAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1082843786 11:57711338-57711360 CGAGTTCCAAACTCAAACCCTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1082843780_1082843786 24 Left 1082843780 11:57711291-57711313 CCTGTAACTAAAACTTTGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1082843786 11:57711338-57711360 CGAGTTCCAAACTCAAACCCTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1082843782_1082843786 3 Left 1082843782 11:57711312-57711334 CCCCAAAGATATTAAATCAGGCC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 1082843786 11:57711338-57711360 CGAGTTCCAAACTCAAACCCTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1082843783_1082843786 2 Left 1082843783 11:57711313-57711335 CCCAAAGATATTAAATCAGGCCT 0: 1
1: 0
2: 0
3: 7
4: 226
Right 1082843786 11:57711338-57711360 CGAGTTCCAAACTCAAACCCTGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082843786 Original CRISPR CGAGTTCCAAACTCAAACCC TGG Intronic
901770232 1:11526474-11526496 CAAGTGCTGAACTCAAACCCAGG + Intronic
901857929 1:12056088-12056110 TAAGTTCCAGATTCAAACCCAGG - Intergenic
902776893 1:18680580-18680602 CAGATTCCGAACTCAAACCCAGG + Intronic
902968329 1:20028548-20028570 CTACTTCAAAACCCAAACCCTGG - Intronic
910832380 1:91473823-91473845 CCAGGCCCAACCTCAAACCCTGG + Intergenic
920019433 1:202943425-202943447 CGAGTCCCAAGCTCAGACCAAGG - Intronic
924875020 1:248093432-248093454 TCAGTGCAAAACTCAAACCCAGG - Intronic
1067777547 10:49174487-49174509 AGAGTCCCCATCTCAAACCCCGG + Intronic
1068410460 10:56647034-56647056 CGGGTTTCAAACACAAACCTGGG - Intergenic
1069106026 10:64384496-64384518 CCAGTTCCAACCTCCAACACTGG + Intergenic
1069842660 10:71349485-71349507 CTAATTCCTAACTCAACCCCAGG + Intronic
1069970713 10:72166070-72166092 TGAGGTCAAAATTCAAACCCAGG + Intronic
1072851341 10:98896226-98896248 CGAATTGCAAAGTCAAACCCAGG + Intronic
1075257033 10:120933497-120933519 CAAGTCCCAAACTCATAGCCTGG + Intergenic
1075931244 10:126297975-126297997 TGAGATCCCAACCCAAACCCTGG - Intronic
1079327264 11:19504985-19505007 GGAGTTCGAGACTGAAACCCAGG + Intronic
1082179580 11:49101955-49101977 AGACTTCCATACCCAAACCCAGG + Intergenic
1082843786 11:57711338-57711360 CGAGTTCCAAACTCAAACCCTGG + Intronic
1089083679 11:115798821-115798843 TGTGTTTCAAACACAAACCCAGG - Intergenic
1097357569 12:58619238-58619260 GGAGATCCAGGCTCAAACCCAGG + Intronic
1104682602 12:130761839-130761861 CCAGTTGCAGACACAAACCCAGG + Intergenic
1104981639 12:132575644-132575666 CGAGTTCCAAGGACAAAACCAGG - Intronic
1110386947 13:74923478-74923500 CCAGTTTCAAACTCAGCCCCTGG - Intergenic
1111478918 13:88795406-88795428 CTAGTTTCAAATTCAAACCTTGG - Intergenic
1112311894 13:98325536-98325558 AGAGTTACAAACTGAAATCCAGG + Intronic
1113719738 13:112546043-112546065 GGAGGTCCAGACTCCAACCCTGG + Intronic
1113719963 13:112547713-112547735 CAAGTCCCAAATTCACACCCTGG + Exonic
1114331720 14:21643711-21643733 AGAGTAGCAAACTCAAATCCAGG - Intergenic
1114760387 14:25308018-25308040 CCAGTTCCTAGCTCAAACCCAGG + Intergenic
1115525731 14:34278878-34278900 CCAGTTCAAAAATAAAACCCAGG + Intronic
1122092715 14:99350682-99350704 CGAGAAACAGACTCAAACCCTGG - Intergenic
1124008339 15:25812100-25812122 AGAGTGCCAAACCCAAACCCTGG - Intronic
1125554100 15:40569841-40569863 CGAGTTCCGAGCTCAGCCCCTGG + Exonic
1125932774 15:43612112-43612134 CTAGTTCCAAACCCTAGCCCAGG - Intronic
1125945873 15:43711574-43711596 CTAGTTCCAAACCCTAGCCCAGG - Intergenic
1131799053 15:96051051-96051073 CTACTTCCAAACAAAAACCCTGG + Intergenic
1135066684 16:19316027-19316049 AGAGTTTCAAACACAAAACCTGG - Intronic
1135480279 16:22815617-22815639 GGAGTCTCAATCTCAAACCCAGG + Intronic
1139350868 16:66334462-66334484 CAAGTGCTAAACTCAATCCCAGG - Intergenic
1143362567 17:6383788-6383810 CCAGGTCCAAAGGCAAACCCCGG - Intergenic
1147396733 17:40149174-40149196 CGAGACCCAAACCAAAACCCTGG - Intronic
1158363403 18:56702747-56702769 CTAGTGCCAAATTCAGACCCTGG + Intronic
1158758116 18:60350718-60350740 GGACTCCAAAACTCAAACCCAGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
928543168 2:32302934-32302956 TCAGTTCTAAATTCAAACCCTGG + Intronic
929366626 2:41166061-41166083 CCACCTCCAAGCTCAAACCCTGG + Intergenic
933194092 2:79369388-79369410 CGAGTCACAAACTCAGACACTGG - Intronic
935336142 2:102018732-102018754 TGAAGTCAAAACTCAAACCCAGG + Intronic
936520194 2:113207125-113207147 GAAGTTTCAAACTCAAATCCAGG + Intronic
942848580 2:180455437-180455459 GGAGTTTCAAACTCAACCCTAGG + Intergenic
944840102 2:203616451-203616473 CGAGCACCAAACTCCCACCCGGG - Intergenic
947642333 2:231714033-231714055 CCAGTGCCAAACCAAAACCCCGG - Intergenic
949058707 2:241944063-241944085 CCAGTGCCAAACACACACCCTGG - Intergenic
1168852070 20:983910-983932 TGAGTGGCAAACTCAAAGCCAGG + Intronic
1169171447 20:3468995-3469017 GGATTTCCACACTCATACCCAGG - Intergenic
1173643158 20:44617429-44617451 GGAGTGCCAAACTCACACCCAGG - Intronic
1174487608 20:50871129-50871151 GGAGCAGCAAACTCAAACCCTGG - Intronic
1178875419 21:36410486-36410508 AGACTTCCAAAATCAAACACTGG - Intronic
1180183831 21:46129851-46129873 AGACTTCCACACCCAAACCCTGG - Intronic
1181775066 22:25153559-25153581 CCAGCCCCAATCTCAAACCCAGG - Intronic
1182253331 22:29019565-29019587 CCAGTTCAAAACTCAAACACAGG + Intronic
1182795510 22:32988903-32988925 AGAGCTGCCAACTCAAACCCAGG - Intronic
949611766 3:5710106-5710128 CAAGTTCCAATTTCAAACCATGG + Intergenic
950327693 3:12127651-12127673 GGATTTCCAAATCCAAACCCAGG - Intronic
953458399 3:43062160-43062182 AGAATCCCATACTCAAACCCTGG - Intergenic
957936512 3:86950922-86950944 TGAATTTCAAACTCAAACTCTGG - Intronic
963885017 3:150572068-150572090 CCAGTTCCAAAGTCAAATACAGG - Exonic
968752920 4:2399535-2399557 CAAGTCCCAAGCTCAAAGCCTGG + Intronic
969324550 4:6433620-6433642 CGGGTTCCAAATCCAGACCCTGG + Intronic
972841467 4:42934933-42934955 CCAATTCCAGACTCAAATCCTGG - Intronic
976050042 4:81000851-81000873 CCAGTTCCAAACTCCAACAGAGG - Intergenic
982874115 4:160624120-160624142 AGAGTTCCAAAATCAAAACAAGG - Intergenic
992795591 5:80252817-80252839 AGATTTCCAAATTGAAACCCAGG + Intronic
998758522 5:145406923-145406945 CCAGTCCCCAGCTCAAACCCAGG + Intergenic
999388376 5:151171944-151171966 GGAGACCCAGACTCAAACCCAGG - Intergenic
1001337166 5:170808699-170808721 AGAGATCCAAAATGAAACCCAGG - Exonic
1003458396 6:6306234-6306256 CCAGTTCAAAAGTCAAAACCTGG + Intronic
1003804212 6:9707316-9707338 CAATTACCAAACTCAAGCCCAGG - Intronic
1004145430 6:13061561-13061583 CAAGATACAAACTCAAACCATGG + Intronic
1004657643 6:17679854-17679876 GGAGATCCAAAATCAAACCAAGG + Intronic
1005970005 6:30753317-30753339 TGAGTTCCCAACCCAAATCCAGG + Intergenic
1011027211 6:82882125-82882147 ATAATTCCAAATTCAAACCCTGG - Intergenic
1013769771 6:113614663-113614685 GCAGTTCAAAACTCAAACTCAGG - Intergenic
1018203592 6:161416534-161416556 CGGCATCCAAATTCAAACCCAGG + Intronic
1023245725 7:38201504-38201526 CGAATTCAAAATTCAAACCAAGG - Intronic
1023346841 7:39279257-39279279 CGAGTTCCAAGCCCCAACACAGG + Intronic
1023792951 7:43768407-43768429 CTGGTTCTAGACTCAAACCCAGG - Intronic
1029245255 7:99194903-99194925 CTGTTTCCAAACTCAAAGCCAGG - Intronic
1033812850 7:145037048-145037070 CAAATTCCAAACTCTAACACAGG + Intergenic
1036910254 8:12753210-12753232 AGAGTTCGAAGCACAAACCCCGG - Intronic
1047976219 8:130133352-130133374 TGAGTGCAAAACTCCAACCCAGG + Intronic
1049293691 8:141818173-141818195 GGAGTGCCAAGCTCAACCCCAGG + Intergenic
1052997064 9:34556850-34556872 CCAGTTCCAAACTAAGACCTGGG + Intronic
1055852487 9:80649186-80649208 CCAGTTCCAAGCTGAAATCCAGG + Intergenic
1058911199 9:109521453-109521475 ATAGTTCCAAACTCAAGGCCAGG - Intergenic
1061594403 9:131619585-131619607 CAGGGTCCAGACTCAAACCCAGG - Intronic
1186812328 X:13202451-13202473 CAAGTTCTAATATCAAACCCAGG + Intergenic
1189712002 X:43823095-43823117 CGAGTTCAGAATTCAAACCCAGG + Intronic
1192492827 X:71591173-71591195 CCAGATCCAAACTCCAGCCCAGG - Intronic
1192493080 X:71593384-71593406 CCAGATCCAAACTCCAGCCCAGG - Intronic