ID: 1082846730

View in Genome Browser
Species Human (GRCh38)
Location 11:57732199-57732221
Sequence GCAAAACTTTAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082846725_1082846730 18 Left 1082846725 11:57732158-57732180 CCTTTTCTCATGTCAATCTGCCT 0: 1
1: 1
2: 34
3: 243
4: 664
Right 1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 263
1082846726_1082846730 -2 Left 1082846726 11:57732178-57732200 CCTTTTGTCAGCTCATTTTCAGC 0: 1
1: 8
2: 49
3: 89
4: 300
Right 1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082846730 Original CRISPR GCAAAACTTTAGAAGGTGGA GGG Intronic
901312667 1:8281583-8281605 GCACCTCTTTACAAGGTGGAAGG - Intergenic
901806612 1:11742777-11742799 CCAACACTTTAGGAGGTGGAGGG - Intronic
902490543 1:16777861-16777883 GGAAAAGTGGAGAAGGTGGAGGG + Intronic
903656339 1:24950815-24950837 GCAGACCTGTAGTAGGTGGAAGG + Intronic
903775377 1:25790039-25790061 ACAAAACTTTGGAAGGGAGATGG + Intergenic
905127527 1:35725953-35725975 GCAAAACATTACAAGTGGGAGGG - Intronic
906100523 1:43257516-43257538 CCAAAACTCTAGAAGGTGAGAGG - Intronic
907061930 1:51435907-51435929 ACAAAACTTTATAAGGTAAAAGG + Intronic
907804941 1:57809517-57809539 GCAAAACTTTTTAAGGTAAAGGG - Intronic
911700001 1:100941716-100941738 GCAAAGCTACACAAGGTGGATGG - Intronic
912304700 1:108555557-108555579 GCAAAGCTTCAGAAGGCAGAGGG - Intergenic
914461474 1:147889786-147889808 GCAAAACTTCAGCAGATGGCAGG - Intergenic
916008785 1:160685733-160685755 GCAAACCTTCAGAAGGTGAAGGG - Intronic
916986679 1:170199403-170199425 GCAAACCTTTAGAGAGTGAAGGG - Intergenic
917346424 1:174032811-174032833 CCAAAACTTTATTATGTGGAGGG + Intergenic
920652770 1:207851211-207851233 GCAAAACTGTAGCTGGTGGGGGG - Intergenic
921951071 1:220930901-220930923 GCAAAACTTGAGAATGTTGTGGG - Intergenic
922996405 1:229965789-229965811 ACAAAATTTTGGAAGCTGGAAGG - Intergenic
923529897 1:234804669-234804691 GGAAAAGTGGAGAAGGTGGAGGG - Intergenic
924212424 1:241784548-241784570 GAAAATGTTTAGAATGTGGAAGG + Intronic
1064468613 10:15612266-15612288 TCAAAGCTTTTGAGGGTGGAGGG - Intronic
1067379358 10:45758926-45758948 ACAAAACTGTAGAAAGAGGAGGG - Intronic
1067887058 10:50099588-50099610 ACAAAACTGTAGAAAGAGGAGGG - Intronic
1068002057 10:51347338-51347360 GGAAAAGCTTAGAAGATGGAAGG + Intronic
1068131595 10:52901943-52901965 GCACATCTTTGGAATGTGGAAGG + Intergenic
1069153866 10:65000469-65000491 GAATAACTGTAGAAGGTGGTGGG - Intergenic
1071960075 10:90801616-90801638 GCAAAACTTCAGAGGGTCAAGGG + Intronic
1073515035 10:104068722-104068744 GCAAAACTATAGAAGCTGTGGGG + Intronic
1075821275 10:125314252-125314274 AGAAAAATTCAGAAGGTGGATGG + Intergenic
1075864881 10:125709223-125709245 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
1080113436 11:28595589-28595611 GCAACATTTTGGAAGCTGGAAGG - Intergenic
1080181668 11:29433286-29433308 GCAAAAGCTTTGAAGGTGTAAGG - Intergenic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1083168674 11:60908648-60908670 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1084114484 11:67033811-67033833 GCAAAACCTTGGAACGTGTATGG + Intronic
1084205246 11:67587491-67587513 GCACATCTTTACAAGGTGGCAGG - Intergenic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1085379737 11:76104134-76104156 GACAAAGTTTAAAAGGTGGAAGG - Intronic
1086306410 11:85485403-85485425 TCAAAAATTTAAAATGTGGAAGG + Intronic
1086508716 11:87532116-87532138 GCAAACCTTCAGATGGTGAAGGG + Intergenic
1086722064 11:90133443-90133465 GCAAAACTTCAGAGGGTGAAGGG - Intronic
1087468509 11:98541757-98541779 GGGAAATTTTAGAAGTTGGAGGG + Intergenic
1087770877 11:102208414-102208436 GCGAACCTTTAGAGGGTAGAGGG + Intronic
1087879237 11:103394989-103395011 GCAAAACTGTGGAAAGAGGAGGG - Intronic
1089691216 11:120187796-120187818 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1091100153 11:132864330-132864352 GCAAACCTTCAGAAGGTGAAGGG + Intronic
1091443124 12:527175-527197 CCAGCACTTTAGCAGGTGGAGGG - Intronic
1093998716 12:25671312-25671334 GCAAAACTTTAGAGGGAAGGAGG - Intergenic
1095491973 12:42744455-42744477 GTAAAACATTAAAAGGTGTAAGG + Intergenic
1097551787 12:61080648-61080670 TCAAAGCTTTAGAAAATGGAAGG + Intergenic
1098279888 12:68851857-68851879 TCATGACTTTAGAAGGGGGAAGG - Exonic
1098703478 12:73658428-73658450 GGAAAAGTTTAGAAGAAGGAAGG - Intergenic
1099287245 12:80729395-80729417 ACAAAATTTCAGAAGGTAGATGG - Intergenic
1099530631 12:83776131-83776153 GCAAAACTGTAGAAGAATGAGGG - Intergenic
1100515647 12:95325066-95325088 GAAAAAGTTCTGAAGGTGGATGG - Intergenic
1102194525 12:111015355-111015377 GCAAAATTTGAGAATGTGGGTGG - Intergenic
1103659818 12:122504876-122504898 GCAAAAATGTAAAAGGTGGAAGG - Exonic
1107322953 13:39209033-39209055 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1108140404 13:47415348-47415370 GCACAACTTCGGAAGGTGAATGG + Intergenic
1109504734 13:63285595-63285617 GCAAAACCATACAAGCTGGAAGG - Intergenic
1112229535 13:97574387-97574409 GCAAACGTTTAGAAGATTGATGG - Intergenic
1112389392 13:98969319-98969341 GCTAAACCTTTGCAGGTGGAAGG + Intronic
1114133668 14:19821391-19821413 ACCAAACTTTAGACGGTGGCTGG - Intronic
1114233502 14:20804123-20804145 GCAAACCTTTGGAGGGTGAAAGG + Intergenic
1114234476 14:20812503-20812525 GCAAAACGTTGCAATGTGGACGG - Intergenic
1115388833 14:32830140-32830162 GCAGAACTTTAAAGAGTGGAAGG - Exonic
1115762894 14:36593169-36593191 GCAAGACTTTGAAAGGTGGTTGG + Intergenic
1116244015 14:42384892-42384914 TCAAAACTTCAGAAGTGGGAGGG + Intergenic
1118172734 14:63404665-63404687 ACAAAACTTTCGAAAGTGTAAGG + Intronic
1118899681 14:69975889-69975911 GAGAACCTTTAGAAGGTTGATGG + Intronic
1119104623 14:71912505-71912527 CCAAAACTGAAGAAGGAGGAAGG + Intergenic
1120757981 14:88262170-88262192 TCTAAAGTTTGGAAGGTGGAGGG - Intronic
1120801342 14:88692018-88692040 GCAAAACCTGAGAACATGGAAGG - Intronic
1121379202 14:93447241-93447263 GGAAAACTTTAAAGGGTGAAAGG - Intronic
1123111826 14:105874510-105874532 ACAAAAAGTTAAAAGGTGGAGGG - Intergenic
1123169435 14:106357797-106357819 GAAAGAGTTTAGAAGGTGTATGG - Intergenic
1123576744 15:21676952-21676974 ACCAAACTTTAGAGGGTGGCTGG - Intergenic
1123613366 15:22119420-22119442 ACCAAACTTTAGAGGGTGGCTGG - Intergenic
1126640020 15:50814874-50814896 CCAACACTTTGGGAGGTGGAGGG - Intergenic
1126744381 15:51811396-51811418 GCACAACTCTAAAAGGGGGAGGG - Exonic
1127211398 15:56778386-56778408 GCAAACCTTCAGAGGGTGGAAGG - Intronic
1127250304 15:57228535-57228557 GCAAAAATTTTGAAGTTGTATGG - Intronic
1127505797 15:59596587-59596609 GCAAACCTTTAGTAGGTGGAAGG - Intronic
1129148042 15:73667614-73667636 CAAAAACTTTAGAAGCTGGAAGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1202985612 15_KI270727v1_random:411197-411219 ACCAAACTTTAGAGGGTGGCTGG - Intergenic
1133605756 16:7386083-7386105 GCAAAACCTTAAAAGCTGGCTGG - Intronic
1134369477 16:13609677-13609699 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1135276452 16:21117369-21117391 GCAAGACTTAAGAAGGGAGATGG + Intronic
1137289911 16:47045376-47045398 ACAAAAATTTAAAAAGTGGAAGG + Intergenic
1138803967 16:60071307-60071329 GCGAAACTAAAGAAGGAGGATGG + Intergenic
1138817101 16:60215177-60215199 GTGAAACTTCAGAAGGTGAAGGG - Intergenic
1139197818 16:64941412-64941434 TCAAAACATTGGGAGGTGGAGGG + Intergenic
1140087050 16:71806488-71806510 CCAACACTTTGGGAGGTGGAAGG - Intronic
1140515803 16:75540454-75540476 GGAAGATTTTAGAAGATGGATGG - Intronic
1147364620 17:39952051-39952073 ACAAAACCTTAGAAGGTGAGAGG + Intergenic
1150063372 17:62088153-62088175 ACAAAATTCTAGAAGCTGGAAGG - Intergenic
1151221065 17:72613533-72613555 GCAGAAGATTAGAGGGTGGAAGG - Intergenic
1153321191 18:3775696-3775718 GCAAACCTTCAGAGGGTGAAGGG + Intronic
1153919707 18:9777693-9777715 ACAAAAGTTTAGAAAGTAGAAGG - Intronic
1156683958 18:39621911-39621933 GCAAACCTTTAGAGGGCAGAGGG + Intergenic
1156947806 18:42856551-42856573 GCAAAACTTCAGAAGGCCAAGGG + Intronic
1159561959 18:70005433-70005455 GCAAGACTTCAGAATGTGCAAGG - Intronic
1164755647 19:30686973-30686995 GGAGGACTTTAGAAGGGGGAGGG - Intronic
1165298700 19:34952235-34952257 CCAAAAATTTAGCAGGAGGAAGG + Intergenic
1166458801 19:42968054-42968076 GCAAACCTTCAGAGGGTGAAGGG - Intronic
1166475748 19:43123325-43123347 GCAAACCTTCAGAGGGTGAAGGG - Intronic
925199389 2:1953969-1953991 GAAAAACCTGAGAAGGTTGACGG + Intronic
925637208 2:5951775-5951797 GCAAGCCTTTAGAAAATGGAGGG + Intergenic
925743073 2:7021846-7021868 TCAAAACTTTAGATGGAGGCTGG + Intronic
928201039 2:29247589-29247611 GCAAAGCTGTAGAGGGTGGGAGG + Intronic
928550535 2:32366316-32366338 ACAAAATTTTTGAAGTTGGAGGG - Intronic
928674945 2:33641171-33641193 GCAAAACTTCAGAGGGTGAAAGG + Intergenic
928738082 2:34315924-34315946 GTGAACCTTTAGAAGGTGAAAGG + Intergenic
929504827 2:42520395-42520417 GCACAACTGAAGCAGGTGGATGG - Intronic
931349243 2:61472864-61472886 ACAAAAATTTAAAAGGTGGCTGG + Intergenic
931689356 2:64822215-64822237 GCAAGCCTTTAGAGGGTGAAGGG + Intergenic
932067407 2:68580449-68580471 GCTAAACTTTTGAGGGGGGATGG + Intronic
932820573 2:74896246-74896268 GAAAACCTTCAGAGGGTGGAGGG + Intergenic
933071547 2:77864737-77864759 TCAAACCTTCAGAGGGTGGAAGG + Intergenic
933745787 2:85570368-85570390 GGAAAGATATAGAAGGTGGATGG + Intronic
934645627 2:96057712-96057734 GCACAACATCACAAGGTGGATGG - Intergenic
934839031 2:97613801-97613823 GCACAACATCACAAGGTGGATGG - Intergenic
934870923 2:97864647-97864669 GAAAAAATTTAGAAGTTAGAGGG + Intronic
935674901 2:105586189-105586211 GCAAAATTTTGGAAGATGGGGGG + Intergenic
937897640 2:126990621-126990643 ACAAAACTTTATAAGGTAGTGGG - Intergenic
939355107 2:141091515-141091537 GCACAACTTTGGAATGTGGGAGG - Intronic
939362284 2:141188158-141188180 GCAATTCTTGGGAAGGTGGAAGG + Intronic
939873470 2:147550321-147550343 GCAACACTATTGAAGGTGCAGGG + Intergenic
939992117 2:148885705-148885727 GAAAAACTTTTGAAGGGAGATGG + Intronic
940385291 2:153064420-153064442 CCAAAACATGAGAAGATGGAAGG - Intergenic
941510858 2:166407612-166407634 GAAAAAGTTTGGAAGGTTGAAGG - Intronic
942051836 2:172147362-172147384 GCAAAACTTCAGAGGGTAAAGGG - Intergenic
942592737 2:177562846-177562868 GATAAACTCTAGAATGTGGAAGG + Intergenic
942623542 2:177874925-177874947 TCAAAACATTACAAGGTGGCCGG + Intronic
942623740 2:177876844-177876866 GCAAACCTTCAGAGGGTAGAAGG - Intronic
943211269 2:184969885-184969907 GCAAACCTTCAGAAGGCGAAGGG + Intergenic
943841546 2:192589473-192589495 GCAATACTTTAAGAGATGGAAGG + Intergenic
945451590 2:210001367-210001389 GCAAACCTTTGGAGGGTGAAGGG - Intergenic
948954437 2:241276114-241276136 GCAATAATATATAAGGTGGAAGG + Intronic
1170085912 20:12531369-12531391 TCAAAACTTTAGAATGTGGTTGG - Intergenic
1170103610 20:12729225-12729247 GAAAAAATTTATAAGGTGGATGG + Intergenic
1170426038 20:16236503-16236525 GCAAAACTTTAAAAGGTCAAGGG - Intergenic
1170709512 20:18777739-18777761 GAAGAGCTTTATAAGGTGGAAGG - Intergenic
1172598016 20:36163826-36163848 GCAGGAATTCAGAAGGTGGAAGG - Intronic
1175745186 20:61451651-61451673 GGAAAACTGTAGAAGGTGGGAGG + Intronic
1178592393 21:33922318-33922340 CCAGCACTTTAGGAGGTGGAGGG - Intergenic
1181017967 22:20082001-20082023 GAAAAACTATAGATGGTGGATGG - Intronic
1182733770 22:32516045-32516067 CCAACACTTTGGGAGGTGGAGGG - Intronic
1182929721 22:34161178-34161200 TCAAAAATTTAGGAGGTTGAGGG - Intergenic
1183615915 22:38945281-38945303 GCAAAACTTCAGAGGGCGAAGGG - Intergenic
1184932247 22:47690163-47690185 GAATAACAATAGAAGGTGGAAGG + Intergenic
949501977 3:4688641-4688663 GCAAATCTATAGAGGGAGGAGGG + Intronic
950511913 3:13434525-13434547 GCAAAACTTCAGAGGATGAAAGG + Intergenic
951223099 3:20089895-20089917 CCAATGCTTTAGGAGGTGGAAGG + Intronic
951444443 3:22762116-22762138 GCAAAATTCTAGGAGGTGAATGG - Intergenic
951989783 3:28663917-28663939 ACATAACTTTAGAAGGTCAAAGG + Intergenic
953438090 3:42895773-42895795 GCAAAACTGGAGAGGGGGGATGG + Intronic
953556305 3:43949291-43949313 GCAAAACTTGAGATGTTGGTGGG + Intergenic
955004330 3:54955020-54955042 GCAAACCTTCAGAGGGTGAAGGG - Intronic
957592315 3:82215493-82215515 ACAAAAGGTGAGAAGGTGGAAGG - Intergenic
959339875 3:105115343-105115365 AATAAACTTTAGGAGGTGGAAGG - Intergenic
963043700 3:141087408-141087430 ACAAAATTGAAGAAGGTGGAGGG + Intronic
964204881 3:154162630-154162652 GCACATCTTTGGGAGGTGGAAGG - Intronic
964514024 3:157487220-157487242 TCAAAACTTTAAAAAGTAGAAGG + Intronic
965415717 3:168389623-168389645 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
965954059 3:174346864-174346886 GCAAAACAGTAGAAGGAGCAAGG + Intergenic
966058909 3:175732174-175732196 GCAAACCTTCAGAGAGTGGAGGG - Intronic
966671272 3:182529176-182529198 GCAAAACTTTTTAAGGGTGAAGG - Intergenic
966963093 3:184960317-184960339 GCAACACTTTAGAATTTGCAAGG + Intronic
967038223 3:185664164-185664186 GGACAACCTTAGAAGCTGGAGGG + Intronic
971016797 4:22497196-22497218 GCAAAGCCATAGAAGGTGGGGGG + Intronic
971434288 4:26603897-26603919 GAAAAAGTTTTGAAGATGGATGG - Intronic
971445370 4:26740861-26740883 GCAAAACTGGAGATGGAGGAAGG - Intronic
971586933 4:28416204-28416226 GCAAAACTTTAGAAGGAAGAGGG + Intergenic
971914316 4:32848758-32848780 GCAAAAGGTTAAAAAGTGGAGGG - Intergenic
973191682 4:47392646-47392668 GCTGAAGATTAGAAGGTGGAAGG - Intronic
974660336 4:64880412-64880434 TCAAAAGTTTAGAAAGAGGAAGG + Intergenic
975864590 4:78713812-78713834 GCAAAACTTCAGAAGGCAAAGGG + Intergenic
979113706 4:116793746-116793768 TCAAAAATTTAGAATGTGGTAGG - Intergenic
980426927 4:132637359-132637381 GCACATCTTCAGAAGGTGGCAGG - Intergenic
981468666 4:145103107-145103129 GCAAAACTTTTTAGGGAGGAGGG + Intronic
982524486 4:156460588-156460610 GCAACATTTTAAAAGGTGGCTGG + Intergenic
982696539 4:158608710-158608732 GAAAAAGTTTTGGAGGTGGATGG - Intronic
982954635 4:161748487-161748509 GTAAAACTTCAAAACGTGGAAGG + Intronic
983575480 4:169256770-169256792 AAAAAAATTTAGAAGGGGGATGG + Intronic
984494285 4:180475207-180475229 GCACATCTTTGGGAGGTGGAAGG - Intergenic
985041208 4:185893531-185893553 TCAAACCTTCAGAAGCTGGAGGG - Intronic
985220961 4:187705071-187705093 GCAAACCTTCAGATGGTGAAGGG - Intergenic
986832832 5:11600102-11600124 GGAAAACTCTAGATGGTAGATGG - Intronic
989167564 5:38446204-38446226 GCAAAAATGGAGGAGGTGGAAGG - Intronic
989641010 5:43583233-43583255 GCAAAACTTCAGAAGGCAAAGGG - Intergenic
989669075 5:43892632-43892654 GCACATCTTTAGGATGTGGAAGG + Intergenic
990206534 5:53435445-53435467 GCAAACCTTTGGAAGTAGGAGGG - Intergenic
990495887 5:56347398-56347420 GCAAACCTTCAGAGGGTAGAAGG + Intergenic
990562847 5:57000829-57000851 GTAAAACTTCAGAGGGTGAAGGG - Intergenic
991240823 5:64458228-64458250 GCAAAACTACAGATGGTGGGGGG + Intergenic
991564441 5:67990219-67990241 GCAAAAGTTTATAAGAGGGAGGG - Intergenic
991708758 5:69385565-69385587 GCAAAATTTTAAAAGTTGGCTGG - Intronic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
993729959 5:91410673-91410695 GCACATCTTTGGAATGTGGAAGG + Intergenic
994974317 5:106782172-106782194 ACAAAACATTAAAAAGTGGAGGG + Intergenic
996438349 5:123460701-123460723 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
997244204 5:132332380-132332402 CCATAACTTTAGGAGGGGGAAGG - Intronic
998402838 5:141856837-141856859 GGAAACCTTGAGAAGGTGGGTGG - Intronic
999594338 5:153185443-153185465 TTCAAACTTTAGAAGGTGGAAGG - Intergenic
1002358109 5:178647419-178647441 GAAAAACATTAAAAGGTAGATGG - Intergenic
1002937827 6:1688473-1688495 CACAAACTTTAGAAGGTGGAGGG - Intronic
1003309384 6:4956199-4956221 GCAAGAAGTTGGAAGGTGGAAGG - Intergenic
1004418089 6:15443483-15443505 CTAGCACTTTAGAAGGTGGAGGG - Intronic
1004493686 6:16143027-16143049 GCAAAACATAAGGAGTTGGAGGG + Exonic
1005096270 6:22120227-22120249 GCAAACCTTTAAAGGGTGAAGGG - Intergenic
1005115597 6:22332089-22332111 GCAAACCTTTGGGATGTGGAAGG + Intergenic
1005652605 6:27898266-27898288 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1006365767 6:33614291-33614313 GCAAGTCTCTAGAAGATGGAGGG + Intergenic
1012341187 6:98125947-98125969 GTAAAAGTTTAAAATGTGGAAGG + Intergenic
1012389755 6:98724318-98724340 GTAAAAATTAAGATGGTGGAGGG - Intergenic
1012876336 6:104732591-104732613 GAAAAAATTCAGAAGATGGATGG + Intronic
1016854962 6:148658271-148658293 GCAACACTTTAGGAGGCTGAGGG + Intergenic
1016864283 6:148749570-148749592 CCAAAACTTTAGGAGCTGGGTGG - Intronic
1017670629 6:156766351-156766373 TTAAAACTGTAGAAGATGGATGG - Intergenic
1017685266 6:156906982-156907004 GCAAGAATTTAAAAGGTGGCTGG - Intronic
1018471665 6:164102640-164102662 GAAATACTTTTGAAGTTGGAAGG - Intergenic
1020683975 7:11270743-11270765 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1021139484 7:17006418-17006440 AGAAAACATTAGAAAGTGGAAGG - Intergenic
1021413017 7:20349978-20350000 GCAAATCTTTGGTGGGTGGAAGG - Intronic
1021507054 7:21397468-21397490 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1021968366 7:25944354-25944376 GAAAAACTTCTGGAGGTGGATGG + Intergenic
1022857627 7:34331169-34331191 GCAAACCTTTCAAAGGTGGATGG - Intergenic
1024170663 7:46781950-46781972 GCCACACTTGAGAAGGTGGTGGG - Intergenic
1024875099 7:54013086-54013108 CCAAAACTATAGAAAGAGGAAGG - Intergenic
1028947118 7:96592669-96592691 GCAGAGATTTAGAAGGTTGAAGG + Intronic
1030684033 7:112465145-112465167 CCAACACTTTGGAAGGAGGAGGG - Intronic
1033121425 7:138669868-138669890 GTAAACCTTTGGAAGGTGAAGGG + Intronic
1034047619 7:147946799-147946821 GCTAACCTTTAGAGGGTGAAGGG - Intronic
1037100909 8:15044687-15044709 GCAAAACTTGGTAAGATGGAGGG + Intronic
1038522840 8:28248019-28248041 ACAAACCTTAAGAAGGGGGAAGG + Intergenic
1039146419 8:34451885-34451907 GTAAAAATTGAGAGGGTGGAAGG - Intergenic
1041101975 8:54405270-54405292 GCAAAAATTTTGGAGATGGATGG + Intergenic
1042082329 8:65068992-65069014 GCAAAACATTAGAAAGTGGTCGG - Intergenic
1044732086 8:95237229-95237251 GCAGGACTCTAGAAAGTGGATGG - Intergenic
1044955327 8:97474284-97474306 GGAGAACTTTAAAAGGAGGAAGG - Intergenic
1045700027 8:104855531-104855553 GCAAAACAAGAGAATGTGGATGG - Intronic
1048641985 8:136373742-136373764 GCAACATTTTAGCAGGTGGCTGG - Intergenic
1050122479 9:2321579-2321601 ACAGAAGATTAGAAGGTGGAAGG + Intergenic
1050818068 9:9840256-9840278 GCAGCACTTTAGGAGGTGGGAGG - Intronic
1051414187 9:16821608-16821630 GCTAAACTGTAGAAGTTGCAAGG + Intronic
1052006502 9:23356284-23356306 GCCAAACTTTACAAGCTAGAAGG - Intergenic
1052500225 9:29279725-29279747 CCAAAACTTTGGGAGGTTGAGGG - Intergenic
1053537842 9:38943885-38943907 GCAAACATTGAAAAGGTGGATGG - Intergenic
1054628292 9:67420040-67420062 GCAAACATTGAAAAGGTGGATGG + Intergenic
1054767472 9:69054247-69054269 CCAAAACTTTGGAAGGCTGATGG - Intronic
1055762309 9:79621974-79621996 GGAAAAGTAAAGAAGGTGGATGG - Intronic
1056432585 9:86542698-86542720 GTAAATCTCTAGAGGGTGGATGG + Intergenic
1056549143 9:87636903-87636925 TCAAAACTTTATCAGGTGGATGG - Intronic
1056807864 9:89742833-89742855 GCAAACGTTTTGAAGATGGAGGG + Intergenic
1057294708 9:93828254-93828276 GAAAAACTTGAGAACGTGGCAGG - Intergenic
1057462039 9:95271869-95271891 GCCATACTTTGGAAGGTGGTTGG - Intronic
1058613052 9:106795673-106795695 GAAAAAATGTAAAAGGTGGAAGG - Intergenic
1059764233 9:117368518-117368540 GCAAAAATTAAGAAGGGAGATGG - Intronic
1060041713 9:120306230-120306252 GCAAAACTGTGGAAGCAGGAAGG + Intergenic
1062260477 9:135660272-135660294 ACAAAACTTTAGAAGGCCCAGGG + Intergenic
1186031445 X:5373541-5373563 GCAAAACTTCTGGAGGTGAATGG - Intergenic
1186589599 X:10916078-10916100 GAAAAACTTTGGAGGGGGGATGG + Intergenic
1188240800 X:27786876-27786898 CCAGAACTTAAGAAGGGGGAGGG - Intergenic
1188395310 X:29675533-29675555 GAAGAACTTTAGGAGGTGGAGGG + Intronic
1188480006 X:30627785-30627807 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1188727946 X:33607933-33607955 GCAAACCTCCAGAAGGTGAATGG - Intergenic
1188770623 X:34148834-34148856 GCACAACTTTAGGATGTGGGAGG + Intergenic
1188796471 X:34472262-34472284 GCACAACTTTAGAATGTGGAAGG + Intergenic
1190455353 X:50622302-50622324 ACAGAACTTTAGAATGTGTAGGG - Intronic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1192139052 X:68631935-68631957 CCAAAAAGTTAGAAAGTGGAAGG + Intergenic
1192188745 X:68977981-68978003 AAGCAACTTTAGAAGGTGGAAGG - Intergenic
1192231430 X:69267755-69267777 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1192239368 X:69317157-69317179 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1192274627 X:69616463-69616485 GCACAACGTCAGCAGGTGGAGGG - Exonic
1192474632 X:71429587-71429609 CCAAACCTTTAGAAGGAGAAAGG + Intronic
1194448073 X:94010960-94010982 ACAAAACTTTAGAAGGCCCAGGG - Intergenic
1194483408 X:94455740-94455762 GCAAAACTTTAGAGGGCAAAGGG - Intergenic
1194498577 X:94651279-94651301 ACAAAACTTTTGAAGGTGATGGG - Intergenic
1194538439 X:95138285-95138307 GCAAACCTTTAGAGGGCAGAGGG - Intergenic
1194757076 X:97749952-97749974 GCAAACTTTCAGAAGGTGAAGGG - Intergenic
1195499254 X:105575331-105575353 GGAACCCATTAGAAGGTGGAGGG - Intronic
1195974153 X:110507710-110507732 CCAAAACTTCAGTAGGTGAATGG + Intergenic
1196279367 X:113804760-113804782 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1200268536 X:154659922-154659944 GCAAAACTGTGGCAGGTGGGAGG + Intergenic