ID: 1082847874

View in Genome Browser
Species Human (GRCh38)
Location 11:57741134-57741156
Sequence AGCGGCCACATGTTGTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082847870_1082847874 25 Left 1082847870 11:57741086-57741108 CCAGGACTGGCAAGAGTTGGAGA 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1082847874 11:57741134-57741156 AGCGGCCACATGTTGTTAGGTGG 0: 1
1: 0
2: 0
3: 0
4: 60
1082847869_1082847874 26 Left 1082847869 11:57741085-57741107 CCCAGGACTGGCAAGAGTTGGAG 0: 1
1: 0
2: 1
3: 27
4: 225
Right 1082847874 11:57741134-57741156 AGCGGCCACATGTTGTTAGGTGG 0: 1
1: 0
2: 0
3: 0
4: 60
1082847868_1082847874 27 Left 1082847868 11:57741084-57741106 CCCCAGGACTGGCAAGAGTTGGA 0: 1
1: 0
2: 2
3: 12
4: 187
Right 1082847874 11:57741134-57741156 AGCGGCCACATGTTGTTAGGTGG 0: 1
1: 0
2: 0
3: 0
4: 60
1082847872_1082847874 -8 Left 1082847872 11:57741119-57741141 CCATAAATCTAGAATAGCGGCCA 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1082847874 11:57741134-57741156 AGCGGCCACATGTTGTTAGGTGG 0: 1
1: 0
2: 0
3: 0
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082847874 Original CRISPR AGCGGCCACATGTTGTTAGG TGG Intronic
901720038 1:11189702-11189724 AGCGGCCAACTGCTGTGAGGAGG + Exonic
906043867 1:42812162-42812184 AGAGGACACATGTTTTTATGTGG - Intronic
912509033 1:110175941-110175963 TGAGGCCACATGTTGGTAAGTGG + Intronic
920596832 1:207280215-207280237 AGCAGCCACATGGTGTGTGGAGG - Intergenic
1064684658 10:17847664-17847686 AGTGGCCACATGCGGTTAAGTGG - Intronic
1064726521 10:18285388-18285410 AGCGGTCACATGTTTTTCTGTGG + Intronic
1076557666 10:131338820-131338842 GGCTGCTACATGTTTTTAGGCGG + Intergenic
1079849997 11:25520608-25520630 ACCTGCCAAGTGTTGTTAGGAGG - Intergenic
1082847874 11:57741134-57741156 AGCGGCCACATGTTGTTAGGTGG + Intronic
1097259846 12:57712771-57712793 AGAGGCTTCATGTTGTGAGGGGG - Intronic
1097803552 12:63940884-63940906 AGCGGCTAGTTGTTTTTAGGCGG - Intronic
1110242157 13:73281243-73281265 AGGAGCCCCATTTTGTTAGGTGG + Intergenic
1125470882 15:40002358-40002380 AGGGGCCTGATGCTGTTAGGTGG + Intronic
1125672310 15:41483004-41483026 AGCGGCTACATGTGGGGAGGTGG - Exonic
1126870865 15:52985597-52985619 AACCACCACATGTTGTTAGATGG + Intergenic
1140069679 16:71638336-71638358 AGGAGCCACATTTTGTTAAGTGG - Intronic
1168281149 19:55306027-55306049 AGAGTCCTCATGATGTTAGGGGG + Intronic
925921779 2:8643458-8643480 AGGGGTCACATGGTGTTGGGGGG + Intergenic
927242886 2:20934026-20934048 TGAGGCCACATTTTGTTAGAAGG - Intergenic
944208763 2:197184738-197184760 AGAGGCCACATGTTGCTACCTGG + Intronic
944414109 2:199466616-199466638 AGAGACCACAGGTTGTTTGGGGG - Intronic
1171856485 20:30349107-30349129 AGCGGTCTCATGTTATTAGAAGG + Intergenic
1178830249 21:36050306-36050328 AAAGGCCAAATGTTGTGAGGAGG + Intronic
1180701939 22:17785900-17785922 AGCAGCCACAGGCTGTTGGGAGG + Intergenic
1181052462 22:20244318-20244340 AGGGGCCCCATGTGGGTAGGAGG - Intronic
1181275498 22:21685262-21685284 AGCGGGCACATGTGGTTCTGTGG + Intronic
1181639808 22:24190503-24190525 AGCGGGCACAGGTTTTCAGGGGG + Intergenic
1181937167 22:26447230-26447252 AGAGGCCACTTTTTATTAGGTGG + Intronic
1184965232 22:47966595-47966617 AGCAGCCACAGGTTGATGGGTGG - Intergenic
952197602 3:31092554-31092576 AGACTCCACATCTTGTTAGGAGG - Intergenic
954265224 3:49466320-49466342 ATCTGCCACTTGCTGTTAGGTGG + Intergenic
956235657 3:67068360-67068382 AGCTGCCACATGTTAATATGTGG - Intergenic
960141154 3:114152888-114152910 AGCGGCCAGATGTTCAGAGGTGG - Intronic
961665923 3:128493042-128493064 AGCGGCCGCATGGTGTTCAGCGG + Exonic
966616726 3:181921442-181921464 GGAGGCCACATGTTGTTATATGG + Intergenic
968312819 3:197698100-197698122 AATGGCCACATGTTGTAAAGAGG - Intronic
973919053 4:55666249-55666271 AGGAGCCACATTTTATTAGGAGG + Intergenic
985546675 5:513445-513467 AGGGGCCACGTGCTTTTAGGGGG - Intronic
1002323193 5:178387890-178387912 AGCTGCCACATCTTGGGAGGAGG - Intronic
1015606983 6:134968075-134968097 AGAGGCCAAATGTGGTTAGTGGG - Intronic
1016190173 6:141255422-141255444 AGCCCCCATATGTTGTTTGGAGG + Intergenic
1018379552 6:163245831-163245853 AGTGGTCCCATGTAGTTAGGTGG - Intronic
1018988478 6:168655421-168655443 AGAGCCCAGATGTTCTTAGGAGG + Intronic
1031995068 7:128225113-128225135 AGCTGCCACATGGAGTCAGGCGG - Intergenic
1035735249 8:1882797-1882819 GGCGGCCACATCTTGTGGGGAGG + Intronic
1036808834 8:11853444-11853466 AGCTGCCACATGTTGGAAGCCGG + Exonic
1042392937 8:68256757-68256779 AGCTGCCTCATGTGGTAAGGTGG + Intergenic
1045598007 8:103678917-103678939 TGCCGACACATGTTTTTAGGTGG + Intronic
1050780882 9:9333547-9333569 AGTGGCCACATGATGAAAGGTGG + Intronic
1053209124 9:36212675-36212697 AGTAGCCATATGTGGTTAGGTGG + Intronic
1053722607 9:40962632-40962654 AGCGGTCTCATGTTATTAGAAGG + Intergenic
1054343358 9:63889365-63889387 AGCGGTCTCATGTTATTAGAAGG - Intergenic
1055393669 9:75850329-75850351 AGCTGCCAGCTGTTGTAAGGGGG + Intergenic
1055420820 9:76139602-76139624 AGGGGGCACATTTTATTAGGTGG - Intronic
1055566253 9:77571446-77571468 AACAGCCACATGTGGTTAGTAGG - Intronic
1061364405 9:130164125-130164147 AGTGGCCACATGTGGCTGGGGGG + Intergenic
1061985554 9:134128304-134128326 GGCAGCGACATGTTGTTAAGAGG - Intergenic
1189294263 X:39907931-39907953 CGAGGTCACATGTTGTTTGGTGG + Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1193608089 X:83593444-83593466 AGCTGCCTCATTTTGTTATGTGG - Intergenic
1201514489 Y:14804351-14804373 AGCAGCCACAAGATGTTAAGAGG - Intronic