ID: 1082848815

View in Genome Browser
Species Human (GRCh38)
Location 11:57747142-57747164
Sequence GCTCAGAACAGACCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082848815_1082848816 -8 Left 1082848815 11:57747142-57747164 CCAGGCAGTGGTCTGTTCTGAGC 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1082848816 11:57747157-57747179 TTCTGAGCCACCTCATTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 161
1082848815_1082848823 29 Left 1082848815 11:57747142-57747164 CCAGGCAGTGGTCTGTTCTGAGC 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1082848823 11:57747194-57747216 ATCTCACTTTGTTTCTTCCATGG 0: 1
1: 0
2: 1
3: 33
4: 315
1082848815_1082848817 -7 Left 1082848815 11:57747142-57747164 CCAGGCAGTGGTCTGTTCTGAGC 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1082848817 11:57747158-57747180 TCTGAGCCACCTCATTTAATGGG 0: 1
1: 0
2: 1
3: 6
4: 109
1082848815_1082848820 4 Left 1082848815 11:57747142-57747164 CCAGGCAGTGGTCTGTTCTGAGC 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1082848820 11:57747169-57747191 TCATTTAATGGGTACTTCCCAGG 0: 1
1: 0
2: 2
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082848815 Original CRISPR GCTCAGAACAGACCACTGCC TGG (reversed) Intronic
900105571 1:979458-979480 GCTCAGGACAGGCCTCAGCCCGG - Exonic
900681456 1:3919127-3919149 GCTCGGAACAGCCCTCTGCCTGG - Intergenic
900827976 1:4941706-4941728 GCCCAACACAGAGCACTGCCGGG - Intergenic
900902864 1:5528528-5528550 GCACAGAACACACCCCTGCTGGG + Intergenic
900959184 1:5908576-5908598 GCTCAGCTCAGACCGCTGGCGGG + Intronic
901490060 1:9592146-9592168 ACTCAGAACTTAGCACTGCCAGG - Intronic
901492115 1:9601954-9601976 GCTCAGAAGAGTCCAGAGCCAGG - Intronic
901849985 1:12008882-12008904 GCTGAGATCATGCCACTGCCTGG + Intronic
902293826 1:15452447-15452469 GCTCTGAACTCACCACTGACAGG + Intergenic
904875446 1:33651338-33651360 GCTCAGAACAGAGCTCTTCTGGG + Intronic
905359988 1:37412579-37412601 GCTCAGAACAGAGCACAAGCCGG - Intergenic
905674457 1:39816038-39816060 GCTCAGAGCACACTACTGCCAGG + Intergenic
906222256 1:44090083-44090105 GCTCTGACCATGCCACTGCCTGG + Intergenic
906953276 1:50351198-50351220 GATCAGACCAGACCAGGGCCTGG + Intergenic
908734548 1:67262445-67262467 GGTCAGGAAAGACCACTCCCAGG + Intergenic
909840491 1:80315509-80315531 GGTCAGAAAAGACCTCTCCCAGG - Intergenic
910333800 1:86105525-86105547 GCTCAGATCAGACCAGCCCCAGG + Intronic
912415174 1:109503424-109503446 GGTCAAACCAGCCCACTGCCTGG + Intergenic
915147155 1:153802000-153802022 GGTGAGAGCAGCCCACTGCCTGG + Intergenic
915798724 1:158765842-158765864 GCACTGAGTAGACCACTGCCAGG + Exonic
915964266 1:160292874-160292896 GTTCAAAACAGACCTCTGCTTGG + Intronic
920308927 1:205036861-205036883 GCACAGAACAGACGCCTACCTGG - Intergenic
921857916 1:220008528-220008550 GCTCAGAATAGAATACTGACAGG + Intronic
922011640 1:221594659-221594681 GACCCAAACAGACCACTGCCTGG - Intergenic
922479189 1:225927068-225927090 CCCCACAACAGACCACAGCCAGG - Intergenic
923860205 1:237885470-237885492 TCACAGAACAGACCCCTACCTGG - Exonic
1063454439 10:6173322-6173344 GCTGAAAGCACACCACTGCCCGG - Intronic
1065299233 10:24305840-24305862 GCTCAGCAGAGACCTCAGCCTGG + Intronic
1065628392 10:27653909-27653931 GCCCAGCACTGACCACTGCCTGG - Intergenic
1069513299 10:69057854-69057876 GCTGAGAAGACACCACTTCCAGG - Intergenic
1070572494 10:77650645-77650667 ACTCAGAAGAGGCCACTGGCTGG - Intergenic
1071318594 10:84428465-84428487 GCTCCTAACAGACCACAGACTGG + Intronic
1071586420 10:86826514-86826536 TTTCATAAAAGACCACTGCCGGG - Intronic
1071680135 10:87696445-87696467 ACTCAGAAGAGAACACTGCTAGG + Intronic
1073395197 10:103211620-103211642 GCTGAGATCACGCCACTGCCTGG + Intergenic
1073427298 10:103463129-103463151 GCTGAGATCATGCCACTGCCTGG + Intergenic
1073727717 10:106253477-106253499 GCTGAGATCACACCACTGCCTGG + Intergenic
1074163913 10:110858255-110858277 GCTCTGATCTGCCCACTGCCTGG + Intergenic
1074430900 10:113393658-113393680 TCTCAGTACAGACCTCTGTCTGG + Intergenic
1074774150 10:116754064-116754086 GCTCATAGCTGACCCCTGCCAGG - Intergenic
1076201370 10:128561271-128561293 GCTCCTAACAGGCCACTGACTGG + Intergenic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1081699312 11:45142790-45142812 GATCAGAACAGAACTGTGCCTGG + Intronic
1081732910 11:45384251-45384273 GCACAGCACAGAGCAATGCCCGG + Intergenic
1082848815 11:57747142-57747164 GCTCAGAACAGACCACTGCCTGG - Intronic
1083375428 11:62216357-62216379 CCTCAGAACAGACCCTTCCCGGG - Intergenic
1083820959 11:65171194-65171216 GCTCAGAACAGAAGGCAGCCGGG - Intronic
1084087999 11:66863537-66863559 GCTCCGGCCAGGCCACTGCCAGG + Intronic
1086489864 11:87348440-87348462 GTTCCTAACAGACCACTGACCGG - Intergenic
1087032696 11:93721862-93721884 GCTCAGAAGTGACAACTGCTGGG + Intronic
1090206280 11:124886137-124886159 GCTGAGATCATGCCACTGCCTGG + Intronic
1090656849 11:128852726-128852748 TCTCAGAACAGGACACTGCCCGG + Intronic
1091088397 11:132746015-132746037 GCTCAGAGCAGAGCCCTGCTGGG - Intronic
1091491342 12:935430-935452 GCTGAGACCACACCACTGCAGGG - Intronic
1091788576 12:3257930-3257952 GCTCAGGCCACACCTCTGCCTGG - Intronic
1092279266 12:7087330-7087352 GCTGAGACCATGCCACTGCCTGG + Intronic
1096400786 12:51304582-51304604 GATCAGAACAGACCAGTTCAGGG + Intronic
1103561841 12:121796983-121797005 GCCCAGATCACACCATTGCCTGG + Intronic
1106648433 13:31662643-31662665 GCTGAGATCACACCACAGCCTGG - Intergenic
1108270142 13:48751407-48751429 GCTCAGTCCAGCCCAGTGCCTGG + Intergenic
1110236690 13:73224292-73224314 GCTGAGATCGCACCACTGCCTGG - Intergenic
1113948762 13:114059647-114059669 CCCCAGGACACACCACTGCCTGG + Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115232859 14:31180124-31180146 GCTGAGATCATGCCACTGCCTGG + Intronic
1120271763 14:82321831-82321853 GTGCAGAACAGACCACAGCGTGG - Intergenic
1122165676 14:99821865-99821887 GCTAACCACAGACCACTGGCAGG + Intronic
1122213314 14:100187250-100187272 GCTGAGATCACACCACTGCACGG + Intergenic
1122272941 14:100576494-100576516 CCTCAGAACAGACCCCCTCCCGG + Intronic
1124235217 15:27984269-27984291 GCCCAGCGCAGACCAGTGCCTGG + Intronic
1124915608 15:33969129-33969151 GCTTCAAACAAACCACTGCCAGG + Exonic
1127801782 15:62483396-62483418 GCTTAGAACAGACCTCTTTCGGG + Intronic
1128145737 15:65331566-65331588 GCTCATCACAGGCCAGTGCCAGG - Exonic
1129074459 15:72980307-72980329 ACACAGAACAGAAAACTGCCAGG + Intergenic
1131129752 15:89890100-89890122 GCTGTGATCACACCACTGCCTGG - Intronic
1131393605 15:92069238-92069260 GCCCAGAACAGCCCCATGCCAGG + Intronic
1131395277 15:92080682-92080704 ACTCAGCACAGAACTCTGCCTGG - Intronic
1132497377 16:270343-270365 GCTCAGGACGGAACACTGACAGG + Intronic
1132527421 16:424690-424712 CCTCAGAAAGGACCACAGCCCGG - Intergenic
1132677700 16:1127456-1127478 TCTGAGAACCAACCACTGCCTGG - Intergenic
1133205885 16:4233251-4233273 GCTCAGAGCACGGCACTGCCAGG - Intronic
1133476127 16:6123851-6123873 GCTGAGAATGTACCACTGCCTGG + Intronic
1134328444 16:13228504-13228526 GCTCAGAGCAGACCTCAGACTGG + Intronic
1135821533 16:25690950-25690972 GCTCTGCACAGAGCTCTGCCAGG - Intergenic
1138216495 16:55209248-55209270 AGTAAGAACAGACCACTGCAGGG - Intergenic
1141623797 16:85250871-85250893 GTCCAGAACAGGCCAATGCCTGG - Intergenic
1141881450 16:86862822-86862844 GCTCAAAACAGAACACAGCGAGG + Intergenic
1142129682 16:88427007-88427029 GCTCAGAGCAGTCCTCGGCCAGG - Intergenic
1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG + Intronic
1143532785 17:7514764-7514786 ACTCAGTACAGAGCAGTGCCTGG - Intergenic
1146201132 17:30859773-30859795 GCCGAGATCACACCACTGCCTGG - Intronic
1146461955 17:33053234-33053256 ACTCAGAACAGACGGCCGCCTGG - Intronic
1146492409 17:33292343-33292365 GCTCGGGAGAGGCCACTGCCAGG - Exonic
1146688251 17:34856151-34856173 GCACACAACAGAACACTGCGGGG + Intergenic
1146728066 17:35171479-35171501 GCACAGACCAGACCCCTCCCGGG - Intronic
1147317358 17:39627326-39627348 GCCCAGCACAGACCGCCGCCGGG + Exonic
1147448649 17:40490291-40490313 CCTCAGAGCAGCCCACTGCAAGG - Intronic
1150705723 17:67485414-67485436 GCCAAGATCACACCACTGCCTGG - Intronic
1151142559 17:72008052-72008074 CCTCAGAGCAGACCTCTGCAGGG + Intergenic
1151220324 17:72606714-72606736 CCTCAGAACAAGCCACTGACTGG + Intergenic
1152030579 17:77839951-77839973 CTTCAGACCAGCCCACTGCCTGG + Intergenic
1152471639 17:80492818-80492840 TCTGAGTACAGATCACTGCCCGG + Intergenic
1152608110 17:81303086-81303108 GCTCTGAGCACACCCCTGCCCGG - Intergenic
1152863777 17:82710431-82710453 TCTCAGCCCAGACCCCTGCCTGG + Intergenic
1152945343 17:83194887-83194909 GTTCCTAACAGACCACAGCCTGG + Intergenic
1156793848 18:41015555-41015577 GCTGAGTACAGAAAACTGCCTGG + Intergenic
1159928007 18:74285798-74285820 GCTGAGATCACACCACGGCCTGG + Intronic
1160419883 18:78736709-78736731 GCTCAGAACAGAGCCAGGCCTGG + Intergenic
1160535349 18:79588676-79588698 GCTCAGGACAGAGCATTGCAGGG + Intergenic
1160701250 19:508481-508503 GCTCAGAACTGGCCCCAGCCAGG - Intronic
1162307971 19:9887063-9887085 CCTCAAAACAGAACAGTGCCTGG + Intronic
1165986824 19:39776827-39776849 GCCGAGATCACACCACTGCCTGG + Intronic
1166325734 19:42049979-42050001 GCCCAGATCATACCACTGCCAGG - Intronic
1166702594 19:44890974-44890996 GCTCAGCACAGACCAATGGCGGG + Intronic
1166996838 19:46723420-46723442 CCTCGGAACTGTCCACTGCCAGG + Intronic
925493518 2:4421852-4421874 GCTCAGTCCAGACCACACCCTGG - Intergenic
926136090 2:10337668-10337690 GCCCAGAACAGAGCAGGGCCAGG - Intronic
927158968 2:20240778-20240800 CCTCAGAATATACCCCTGCCAGG + Intergenic
927857691 2:26537597-26537619 GCTCAGAGCAGGCCAGTGCCTGG + Intronic
927890072 2:26742607-26742629 GCTGAGGGCAGATCACTGCCGGG + Intergenic
929030349 2:37644582-37644604 GCTCAGAAATGACCACTGAGAGG + Exonic
929212601 2:39374314-39374336 GCCAAGATCACACCACTGCCTGG + Intronic
929403873 2:41617575-41617597 GCTCAGAACTCACCACCTCCAGG + Intergenic
929490302 2:42390365-42390387 GCTCAGAATAGATCATTCCCTGG - Intronic
931022115 2:58058102-58058124 GCTCAGAATAGAACACTGAGAGG + Intronic
933774697 2:85765069-85765091 GCTCAGCACTGACCCCTGACTGG - Intronic
933775975 2:85771477-85771499 GCTCAGAAAAGGGCAGTGCCAGG + Intronic
935031689 2:99328935-99328957 GCTGAGATCACGCCACTGCCTGG + Intronic
935505834 2:103901458-103901480 GCTGAGATCACTCCACTGCCTGG - Intergenic
935976347 2:108582714-108582736 GCCAAGATCATACCACTGCCTGG + Intronic
938581670 2:132652048-132652070 CCTCAGAAACCACCACTGCCGGG + Intronic
939401849 2:141704720-141704742 GGTTAGAAGAGACTACTGCCAGG - Intronic
941391557 2:164921371-164921393 GCTATGATCACACCACTGCCTGG - Intronic
947693996 2:232166967-232166989 GCTGAGATCATGCCACTGCCTGG + Intronic
948604027 2:239123447-239123469 GCCCAGCACAGGCCACAGCCTGG - Intronic
948852772 2:240716506-240716528 GCCCAGGACAGATCACAGCCTGG + Exonic
949058623 2:241943614-241943636 GCTCAGAGGAGAGCACTCCCCGG + Intergenic
1169407199 20:5331749-5331771 GTTCATAACAGACCACAGACTGG + Intergenic
1170285529 20:14704295-14704317 GCCCATTACAGCCCACTGCCTGG - Intronic
1171274766 20:23847284-23847306 GCTCAGCAGAGGCCACAGCCAGG - Intergenic
1171282357 20:23911380-23911402 GCTCAGCAGAGGCCACAGCCAGG - Intergenic
1171340175 20:24421277-24421299 GCTCATCACAGGACACTGCCAGG + Intergenic
1172461758 20:35124181-35124203 GCTCAGAGAAGTCCAGTGCCTGG - Intronic
1172536698 20:35679233-35679255 GCCGAGATCACACCACTGCCTGG - Intronic
1176084744 20:63290830-63290852 GGTCAGAACAGAGCAGGGCCAGG - Intergenic
1178352277 21:31880830-31880852 TCTCAGAACTGACCTCTGCAAGG + Intronic
1178685640 21:34708471-34708493 TCCCAGAACTGGCCACTGCCAGG + Intronic
1179189948 21:39115259-39115281 CCTCAGCACAGCCCCCTGCCAGG + Intergenic
1179243349 21:39610564-39610586 GGACAGAGCAGACCACTGCCTGG + Intronic
1179964470 21:44793434-44793456 GCTCAGCACAGAGACCTGCCCGG + Intronic
1181152399 22:20894237-20894259 CCCCAGAAAAGTCCACTGCCTGG - Intergenic
1181264762 22:21624479-21624501 CCCCAGTACAGCCCACTGCCAGG + Intergenic
1182593881 22:31403111-31403133 CCTCAGAATATACCCCTGCCAGG - Exonic
1184094656 22:42310021-42310043 GGGCAGAACAGCCAACTGCCCGG + Intronic
1184285063 22:43465848-43465870 GCTGAGATCAGAGCACTGCAGGG + Intronic
1184942378 22:47778479-47778501 GCACAGAACACAGCACTGCGTGG + Intergenic
1185253031 22:49815629-49815651 GCTCACAACAGAGCCCTTCCTGG - Intronic
951586370 3:24219248-24219270 GCTGTGATCACACCACTGCCTGG + Intronic
951661206 3:25068692-25068714 CCTCAGCACAAAGCACTGCCTGG + Intergenic
952310945 3:32189788-32189810 GCTGAGCACAGAACACAGCCAGG - Intergenic
952806627 3:37361252-37361274 ACTCAGAAGATACCACTGCGAGG - Intronic
953523194 3:43662854-43662876 GCTCTGAACAGACCAATAACAGG + Intronic
953610358 3:44442775-44442797 GCTCAGAACCACCCACAGCCGGG + Exonic
953765550 3:45738009-45738031 GCTAAGAACACACCAGTACCCGG - Intronic
954791491 3:53136502-53136524 GCTCAGCACTGGCCACTGACTGG - Intergenic
956646598 3:71463310-71463332 GCTGAGATCACACCACTGCTGGG + Intronic
958147165 3:89640395-89640417 GCACAGTACACACCACTGCATGG + Intergenic
961215813 3:125159684-125159706 GGTCAAACCAGAACACTGCCTGG - Intronic
961994189 3:131223720-131223742 GCTCAGAAGAAACCTCTGCAAGG - Intronic
966159165 3:176949936-176949958 TCTCAGAATAGAACACTGCATGG - Intergenic
967036711 3:185653567-185653589 GCCGAGATCAAACCACTGCCTGG + Intronic
968476730 4:813992-814014 ACACAGCAAAGACCACTGCCTGG + Intronic
968544153 4:1188157-1188179 GCCAAGATCACACCACTGCCTGG + Intronic
968882083 4:3306292-3306314 CCTCTGAGCAGCCCACTGCCAGG - Intronic
968944785 4:3658022-3658044 GCTCAGAACACACAGCGGCCGGG + Intergenic
971212936 4:24637242-24637264 GCTCCTAACAGGCCACAGCCAGG - Intergenic
971247851 4:24946383-24946405 GCTAAGTACAGACCACTTCAAGG - Intronic
973712747 4:53645376-53645398 GCTGAGAACAGCCCACAGCAGGG - Intronic
973733199 4:53843537-53843559 GCTGAGATCACACCACTGCCTGG + Intronic
974047972 4:56913209-56913231 GCTGTGATCACACCACTGCCTGG - Intronic
976661804 4:87547484-87547506 GCTCAGCAAAGACCTCTGTCTGG - Intergenic
976850749 4:89542122-89542144 GCTCAGAACAGCCCAGAGACAGG + Intergenic
981020920 4:140027461-140027483 GCTCTGCACAGAACACTGCCAGG + Intronic
981835936 4:149053362-149053384 GCTCAGCACAGACCAATGGCAGG + Intergenic
985924323 5:3004237-3004259 GCTCAGAACAGCCAGCTGCCAGG + Intergenic
986685178 5:10270132-10270154 GCTGAGATCACACCACTGCCTGG + Intergenic
988218550 5:28311038-28311060 GCTCAGAAGTGCCCACTCCCTGG + Intergenic
988347098 5:30051449-30051471 GTTCCTAACAGACCACTGACAGG - Intergenic
988522305 5:31957378-31957400 GCACATCACAGACCAGTGCCTGG + Intronic
989271317 5:39536674-39536696 GCTGAGATCACACCACTGCCTGG + Intergenic
992034133 5:72754667-72754689 ACTCAGAACAGTCCACTACAGGG + Intergenic
992198057 5:74359052-74359074 TTTGAAAACAGACCACTGCCTGG - Intergenic
996095693 5:119396470-119396492 GCTCTGAACCCACCACTGCTAGG - Intronic
997400968 5:133601978-133602000 GCAGAGAACAGAACACTTCCAGG - Intronic
999256443 5:150212250-150212272 GCTCAGAACAGCCCCCAGCCTGG + Intronic
999732014 5:154482221-154482243 GGTCAGAACAGAGCCCTGCAAGG - Intergenic
1001941376 5:175742101-175742123 GCTGAGATCACGCCACTGCCTGG + Intergenic
1002643220 5:180640411-180640433 GCTCAGGCCAGACCCCAGCCCGG + Intronic
1004121061 6:12822516-12822538 GGTCAGAAGAAACCACAGCCGGG + Intronic
1007500948 6:42296395-42296417 ACTGAGAACAGACCACTTCAAGG - Intronic
1008811430 6:55505327-55505349 CCTCAGAAGAGAACAATGCCAGG + Intronic
1009286135 6:61820273-61820295 GCTCAGATCAGACCACACCATGG + Intronic
1010198239 6:73261389-73261411 GCTAAGATCACGCCACTGCCTGG + Intronic
1014203593 6:118630750-118630772 GCTCCCAACAGGCCACTGACCGG - Intronic
1015798015 6:137032361-137032383 GCCCAGAGATGACCACTGCCTGG - Intronic
1019417061 7:932634-932656 GCTCAGACAAGCCCACAGCCTGG + Intronic
1020153242 7:5700178-5700200 TCTCAGCACAGAGCACTGCAGGG - Intronic
1023027887 7:36067584-36067606 CCTCAGAACAGCCAAGTGCCTGG + Intergenic
1024048594 7:45601961-45601983 TCTCAGAAGTGACCAGTGCCAGG + Intronic
1024705282 7:51951051-51951073 GCTCAGACCAAACCAGAGCCAGG - Intergenic
1024800399 7:53071171-53071193 GCTCAGAACAAGACACTGACAGG + Intergenic
1024996931 7:55279320-55279342 TCTCAGAGAAGAACACTGCCTGG + Intergenic
1026486915 7:70829819-70829841 GCTAGGAACACTCCACTGCCTGG - Intergenic
1029518008 7:101039696-101039718 CCTCAGAACTGGCCACTGGCAGG - Exonic
1029642574 7:101830258-101830280 GCTCAGAACAGAAGCCTGCGTGG - Intronic
1030066069 7:105660121-105660143 CCTCCGTACACACCACTGCCTGG + Intronic
1034669319 7:152846178-152846200 GCTCACTACAGACTACAGCCCGG - Intronic
1034669331 7:152846241-152846263 GCTCACTACAGACTACAGCCCGG - Intronic
1034669349 7:152846365-152846387 GCTCACTACAGACTACAGCCCGG - Intronic
1034669363 7:152846459-152846481 GCTCACTACAGACTACAGCCCGG - Intronic
1034669369 7:152846490-152846512 GCTCACTACAGACTACAGCCCGG - Intronic
1034669439 7:152846925-152846947 GCTCACTACAGACTACAGCCCGG - Intronic
1034669468 7:152847111-152847133 GCTCACTACAGACTACAGCCCGG - Intronic
1034669477 7:152847174-152847196 GCTCACTACAGACTACAGCCCGG - Intronic
1034831624 7:154313247-154313269 GAGCAGAACAGTCCACAGCCAGG + Intronic
1035592022 8:823597-823619 GCTCTGCACAGACCCCTTCCTGG + Intergenic
1040297848 8:46170901-46170923 GCTCAGAAAAGACCCTTCCCAGG + Intergenic
1043544698 8:81302180-81302202 GTTCCTAACAGGCCACTGCCGGG - Intergenic
1048255759 8:132904071-132904093 GCTCAGAGCACAACACTTCCTGG + Intronic
1049141837 8:140962167-140962189 GCTGAGATCACACCACTGCCTGG + Intronic
1049838913 8:144757970-144757992 GCTGCGGACACACCACTGCCTGG - Intergenic
1050021366 9:1287689-1287711 GATGAGAACATACCAATGCCTGG + Intergenic
1050435911 9:5610642-5610664 GATCAAACCAGTCCACTGCCTGG + Intergenic
1052197148 9:25731853-25731875 GCTGAGATCACACCACTGTCTGG + Intergenic
1053236145 9:36456110-36456132 GCTGAGATCACGCCACTGCCTGG - Intronic
1055862880 9:80774455-80774477 GCTATGATCACACCACTGCCTGG + Intergenic
1055931788 9:81566575-81566597 GTTCAGAACAGCCCCCTGCGGGG - Intergenic
1058588495 9:106535515-106535537 CCTCAGACAAGACAACTGCCAGG - Intergenic
1060819892 9:126655216-126655238 GCTCAGCCCTGACCACTGCTTGG + Intronic
1061759261 9:132838751-132838773 GCTCAGAACAGAGGGCTGACAGG - Intronic
1062040224 9:134401145-134401167 GCTCAGAACTGACCAGGTCCTGG + Intronic
1062474785 9:136721643-136721665 GCACAGCAAAGGCCACTGCCTGG - Intronic
1062571254 9:137186409-137186431 GCCCAGAACAGCCCCATGCCAGG + Intronic
1188870363 X:35364463-35364485 TATCAGAACTTACCACTGCCTGG - Intergenic
1189505131 X:41605728-41605750 GCTAAGATCACACCACTGCACGG - Intronic
1190299630 X:49049451-49049473 GCTCCTAACAGGCCACTGACTGG + Intergenic
1194136388 X:90149232-90149254 GCCGAGATCACACCACTGCCTGG - Intergenic
1196143890 X:112296080-112296102 GCTCTGAGGGGACCACTGCCAGG + Intergenic
1199304600 X:146252430-146252452 GCCGAGATCACACCACTGCCTGG + Intergenic
1200482145 Y:3719297-3719319 GCCGAGATCACACCACTGCCTGG - Intergenic
1202342096 Y:23880653-23880675 CCTCAGAACAGACCACTTAAGGG + Intergenic
1202528673 Y:25789432-25789454 CCTCAGAACAGACCACTTAAGGG - Intergenic