ID: 1082850717

View in Genome Browser
Species Human (GRCh38)
Location 11:57761962-57761984
Sequence CTGAGAAAGACAAATCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082850717_1082850722 12 Left 1082850717 11:57761962-57761984 CCTGCTGGATTTGTCTTTCTCAG 0: 1
1: 0
2: 1
3: 29
4: 304
Right 1082850722 11:57761997-57762019 GCCTTGGGTTTCTTTCTTAAAGG 0: 1
1: 0
2: 2
3: 32
4: 312
1082850717_1082850719 -4 Left 1082850717 11:57761962-57761984 CCTGCTGGATTTGTCTTTCTCAG 0: 1
1: 0
2: 1
3: 29
4: 304
Right 1082850719 11:57761981-57762003 TCAGCACCTTGGCGAAGCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 153
1082850717_1082850720 -3 Left 1082850717 11:57761962-57761984 CCTGCTGGATTTGTCTTTCTCAG 0: 1
1: 0
2: 1
3: 29
4: 304
Right 1082850720 11:57761982-57762004 CAGCACCTTGGCGAAGCCTTGGG 0: 1
1: 0
2: 1
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082850717 Original CRISPR CTGAGAAAGACAAATCCAGC AGG (reversed) Exonic
900683090 1:3928637-3928659 CCAAGAAAAACAAAACCAGCAGG - Intergenic
903964990 1:27082424-27082446 AAGAAAAAGACAAATCCAACTGG - Intergenic
904912100 1:33942758-33942780 CTCAGAGAGATAAACCCAGCTGG - Intronic
905653952 1:39673990-39674012 CTGAGAAAGACAAATCTGCTTGG - Intergenic
906911030 1:49950981-49951003 CATAGAAAGACAAATACTGCAGG + Intronic
907501446 1:54884571-54884593 CTGAGATAGACAAGTGCAGGGGG + Intronic
907746041 1:57214612-57214634 CTTAGAAAAACAAAACAAGCCGG + Intronic
907798943 1:57744879-57744901 CTGAGAAAGAAAATTGCAGGTGG - Intronic
909971137 1:81991109-81991131 TAGAGAAGGACAAATGCAGCTGG + Exonic
910373012 1:86538260-86538282 CTGGGAAAAACAAATTTAGCAGG - Intergenic
911099574 1:94084328-94084350 ATGAGAATTACAAGTCCAGCTGG - Intronic
911458989 1:98165085-98165107 CTGAAAAAGACAAAACCTACAGG - Intergenic
912479117 1:109965357-109965379 CAGAAATGGACAAATCCAGCAGG + Intergenic
914464822 1:147917662-147917684 ATGAGAAAGAAAAATACAACTGG - Intergenic
915898946 1:159832853-159832875 CTGGGAAAGAAAAGTACAGCTGG - Intronic
916274173 1:162976205-162976227 CTGAGAAAGACAGAACCAGTAGG + Intergenic
916744545 1:167674908-167674930 CTAATAAAGACATATCCAGCCGG + Intronic
919040060 1:192374890-192374912 CTGAGAAACACAAATGCAGTGGG - Intergenic
921138906 1:212286368-212286390 CTGAGCAGGAGAAACCCAGCAGG - Intronic
921300202 1:213744756-213744778 CAAAGACAGACAAATCCATCTGG - Intergenic
921367644 1:214388779-214388801 CCAAGAAACCCAAATCCAGCAGG + Intronic
921445828 1:215246097-215246119 CTGAGAAAGAGAGAGCAAGCAGG + Intergenic
921487857 1:215735831-215735853 TTTAGAAAGACAAATCCATCTGG - Intronic
921828660 1:219702378-219702400 GGGACAAAGACAAGTCCAGCAGG + Intronic
922038439 1:221872737-221872759 CTGAGGCAGACATGTCCAGCAGG - Intergenic
922061503 1:222096996-222097018 CTTAGAAAGACAAGTCTAGCAGG - Intergenic
922226994 1:223654191-223654213 CTCAGAAACACAAACCCAGACGG + Intronic
922398003 1:225222733-225222755 CTGTGAGAGGCAAAGCCAGCTGG - Intronic
922662627 1:227443513-227443535 GTGATAAAGACAGATGCAGCCGG - Intergenic
924942286 1:248820494-248820516 CTGAGAAAGAATATTCCAGCAGG - Intronic
1063894907 10:10669675-10669697 GTGAAAATGACTAATCCAGCTGG - Intergenic
1066511366 10:36100773-36100795 CAGAAATAGACAGATCCAGCAGG + Intergenic
1067037485 10:42931035-42931057 CTGAGAAGGGCAAGTGCAGCAGG - Intergenic
1067235016 10:44439774-44439796 CTCAGAAAGACCTTTCCAGCAGG + Intergenic
1068551191 10:58410067-58410089 CTGTGAGAGGAAAATCCAGCTGG - Intergenic
1071428784 10:85586748-85586770 CAGAAATGGACAAATCCAGCAGG + Intergenic
1074509121 10:114097127-114097149 CTGAGGAAGAGAAAGCCAGAGGG + Intergenic
1074860318 10:117505052-117505074 CTGAGAAAGCAAAATTCCGCTGG - Intergenic
1075168768 10:120093621-120093643 CAGAAAAAGACAAATACTGCAGG - Intergenic
1075197797 10:120376139-120376161 CTGAGAAATACTATTTCAGCAGG - Intergenic
1076637213 10:131889904-131889926 CTGAGAAAGACAAACCCCCTGGG - Intergenic
1078352550 11:10606441-10606463 CTTAGATACACAAAACCAGCTGG - Intronic
1078486267 11:11726187-11726209 ATGAGAAAGGCAAATCCATGAGG + Intergenic
1080812971 11:35724238-35724260 CTGTGAAAGACAAAGCCTACAGG - Intronic
1081381699 11:42424346-42424368 CTGAGAAAGACAATTCTCACTGG + Intergenic
1081608238 11:44541138-44541160 CTGAGAGAGGCCAACCCAGCTGG + Intergenic
1081742917 11:45453522-45453544 CTGAGAAAGAGACATTGAGCAGG + Intergenic
1082850717 11:57761962-57761984 CTGAGAAAGACAAATCCAGCAGG - Exonic
1082898871 11:58223988-58224010 CACAGAAAGACAAATACTGCAGG + Intergenic
1082950521 11:58810231-58810253 CTCAGAAAGACAAATGCTTCAGG - Intergenic
1087716015 11:101609812-101609834 TTCAGGAAGATAAATCCAGCAGG + Intronic
1087785925 11:102354126-102354148 CAGAGAAAGACAAATACAACTGG - Intronic
1087977788 11:104571240-104571262 CTCAGAAACACAAATCCTCCAGG - Intergenic
1088336622 11:108711871-108711893 CAGGAATAGACAAATCCAGCAGG - Intronic
1089122210 11:116145394-116145416 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1089565907 11:119371620-119371642 CTGATCCAGACAAATGCAGCAGG - Intronic
1089691647 11:120190554-120190576 CTGAGCAGGACAAATGCAACGGG + Intergenic
1089906244 11:122042435-122042457 CTGAGAAAGAAAAATGCAACTGG - Intergenic
1089932650 11:122329586-122329608 CTCAGAAAGATAATTCCAACAGG + Intergenic
1090945281 11:131424386-131424408 CTGAGAAACTGAAATTCAGCTGG - Intronic
1091023541 11:132122414-132122436 CTGTTAAAGTCAAATCCAGGAGG + Intronic
1092569626 12:9708374-9708396 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1092651637 12:10641357-10641379 CTTAGAAGGAAAAACCCAGCAGG - Intronic
1099381817 12:81963946-81963968 CTGAGAAAGACAATTTAAGCAGG + Intergenic
1099542234 12:83926798-83926820 CTGATATAGCTAAATCCAGCAGG + Intergenic
1099870672 12:88345506-88345528 CTGAGAGAGAAAACTCCAGGGGG - Intergenic
1100424151 12:94466770-94466792 CTCACAAAAAAAAATCCAGCAGG + Intergenic
1101135243 12:101737628-101737650 ATGAGAAACACAAGTACAGCTGG + Intronic
1101455367 12:104825619-104825641 CTGAGAACTGCAAATTCAGCAGG + Intronic
1101732867 12:107440951-107440973 CTGAGCAAGTCACTTCCAGCTGG - Intronic
1102282438 12:111629087-111629109 CTTAAAAAGTCAAAGCCAGCCGG + Intergenic
1104502393 12:129298724-129298746 CACAGAAAGACAAATACCGCAGG - Intronic
1104833968 12:131775049-131775071 CTGTGAAAGACAAAACCAAACGG - Intronic
1106028073 13:25974046-25974068 CTGAGGAAAAAAAATGCAGCTGG - Intronic
1106556776 13:30816681-30816703 GTGGGAGAGGCAAATCCAGCTGG - Intergenic
1107275014 13:38668239-38668261 CATAGAAAGACAAATCCTGCAGG + Intergenic
1107520699 13:41177611-41177633 CTTAGAATGACTAATCCAGTTGG + Intergenic
1107629296 13:42327092-42327114 CTGAGAAACACACATCTAGCTGG + Intergenic
1107758690 13:43652835-43652857 AGGAGAAAGACAAAACCAGGAGG + Intronic
1109152244 13:58859738-58859760 CTGAGAAATGCAAATTCGGCAGG - Intergenic
1110023873 13:70510954-70510976 CACAGAAAGAAAAATCCAACAGG - Intergenic
1110852871 13:80264375-80264397 CTGTGAAACACAAAACCATCAGG + Intergenic
1110896788 13:80762890-80762912 TTGAGAAAGAGAACTCCAGGTGG + Intergenic
1111292359 13:86186091-86186113 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1111467788 13:88640210-88640232 CTGGCAAAGTCAGATCCAGCTGG + Intergenic
1111663381 13:91238439-91238461 CTGAGAAAGAAAATGCCAGCTGG + Intergenic
1111909744 13:94297541-94297563 CTGAGAAATGCAAATCCTTCAGG + Intronic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1116448195 14:45036833-45036855 CTGATAAAGACATATCCAAGAGG + Intronic
1116541059 14:46101965-46101987 CTGAGACATACAAAACCAGTTGG - Intergenic
1117315894 14:54569674-54569696 CTGAGAAAGTAAAACCGAGCAGG - Intronic
1117831252 14:59753273-59753295 CTGAGCAAGACAGAGCCAGTAGG - Intronic
1118324711 14:64773181-64773203 TAGAGAAAGACAAAAACAGCAGG + Intronic
1120630436 14:86883668-86883690 TTTAGAAAGATAAATCCAGGAGG - Intergenic
1121222104 14:92293690-92293712 ATGAGAAACACAGATCCAGAAGG - Intergenic
1121224924 14:92314701-92314723 CCCAGAAAGACAAAACCAGATGG - Intergenic
1121279706 14:92689620-92689642 GTGAGACAGACAAGTCCAGGGGG - Intergenic
1121410130 14:93743977-93743999 GTGAGACAGACAAAACCAGCGGG - Intronic
1123960324 15:25392044-25392066 CAGAGGAAGACAAAACCAGAAGG + Intronic
1124057885 15:26259399-26259421 CACAGAAAGACAAATACTGCAGG + Intergenic
1125138304 15:36370208-36370230 CTGGGAAAGACAGATCCCGTTGG - Intergenic
1127300339 15:57646842-57646864 CTGATAAAGAGAAATCTATCTGG + Intronic
1127990530 15:64112261-64112283 CTGAGAAAGAGAAATACATTTGG + Intronic
1128951371 15:71886592-71886614 CTGAGAAAGATACATCTAGCTGG - Intronic
1128979461 15:72175919-72175941 CAGAGAATGACACACCCAGCAGG + Intronic
1130287468 15:82567882-82567904 GGCAGGAAGACAAATCCAGCGGG + Intronic
1130985727 15:88843332-88843354 CTGTGAAGGACACAGCCAGCTGG - Intronic
1131897481 15:97049296-97049318 CTGATAAAGACATATGCAACTGG - Intergenic
1132145807 15:99429075-99429097 CACAGAAAGACAAATACCGCAGG + Intergenic
1133449379 16:5890946-5890968 CTGAGAAATTCAGATCCAGGCGG - Intergenic
1133644304 16:7748916-7748938 AAGAAAAAGACAAAACCAGCTGG + Intergenic
1133989787 16:10695736-10695758 CTGGAAAAGACAAATCCATACGG + Intergenic
1134448947 16:14351773-14351795 CACAGAAAGACAAATACCGCAGG - Intergenic
1136302264 16:29343681-29343703 CAGAGACAGACACAGCCAGCAGG - Intergenic
1137967598 16:52952264-52952286 CTGAGAAAGAAAATCCCAGTTGG + Intergenic
1138435347 16:56995873-56995895 CAGAGAAAGACCTATCCAGTAGG + Intronic
1138602642 16:58065759-58065781 CTAAAAAAAAAAAATCCAGCCGG - Intergenic
1140066457 16:71615496-71615518 CTGAGAAAGGCCACGCCAGCTGG - Intergenic
1140416659 16:74778529-74778551 CTGAAAGAGACAAAGCCAGCTGG - Intergenic
1141218141 16:82044179-82044201 ATGAGCAACACAAACCCAGCTGG + Intronic
1143394052 17:6577822-6577844 CAGAGAAAGGCAGATCCACCTGG + Intergenic
1144200212 17:12934294-12934316 CTGGGAAAGACAACAACAGCAGG + Intronic
1144238899 17:13290017-13290039 CTTTAAAAGACAAATCAAGCCGG - Intergenic
1145309435 17:21693325-21693347 TAGATAAAAACAAATCCAGCTGG + Intronic
1146782508 17:35687414-35687436 CTAAAACAGAAAAATCCAGCTGG - Intronic
1146923403 17:36728540-36728562 CCGTGACAGACAAATACAGCCGG - Intergenic
1147246484 17:39124429-39124451 CAAAGAAAGACAAAACTAGCTGG + Intronic
1147895397 17:43747811-43747833 CAGAGAAAGTAAAATCCATCTGG + Intergenic
1148023002 17:44566023-44566045 CTGAGAACTGCAAATTCAGCAGG - Intergenic
1149854630 17:60070061-60070083 CTGACCAAACCAAATCCAGCTGG - Intronic
1151322431 17:73359936-73359958 CTGAGAAAGAAAGAACCAGCCGG - Intronic
1152118757 17:78405290-78405312 CTGAGAAAGGCATTGCCAGCCGG - Intronic
1153515786 18:5899838-5899860 CTGAGAAAGACAAATGAATGGGG - Intergenic
1153516392 18:5906391-5906413 GTTAAAAAGACAAATCCAGTCGG - Intergenic
1153683685 18:7524656-7524678 CTGAGAAAGGCAAATAATGCAGG - Intergenic
1158448063 18:57538253-57538275 CTGAGACAGAACATTCCAGCAGG + Intergenic
1159056402 18:63469146-63469168 CTCAGAAACACAAAGTCAGCTGG - Intergenic
1160129904 18:76215770-76215792 TTGAAAAAGACAAAACCAGAGGG - Intergenic
1160595445 18:79970532-79970554 CTCAGAAAGACGAATCCTGTTGG - Exonic
1161749574 19:6084931-6084953 CACAAAAGGACAAATCCAGCCGG - Intronic
1164744574 19:30601646-30601668 CTGAGAAACACAAAGCAAGGTGG + Intronic
1165055550 19:33174222-33174244 CAGAGCAAGTCAAATGCAGCAGG - Intronic
1166502142 19:43349601-43349623 CTGAGTCAGACACATCCAGGTGG + Intergenic
1166946096 19:46397390-46397412 CTTAGAAAGCAAAAACCAGCCGG - Intergenic
1167252450 19:48407267-48407289 ATAAGAAAGACAGAACCAGCTGG - Intronic
1167312298 19:48744078-48744100 CAGAGAATGACAAAACCACCAGG + Intronic
1168086651 19:54052517-54052539 CTCAGAAAGACAAATTCTGCAGG - Intronic
925181904 2:1822839-1822861 CTGAGAAAGAGAAACCCTCCAGG - Intronic
925250234 2:2427905-2427927 CACACAAACACAAATCCAGCAGG - Intergenic
926799594 2:16648153-16648175 CTGAGATAGATAAAACCACCTGG - Intronic
926846805 2:17150048-17150070 CTGAGAAAGGCCAACTCAGCGGG - Intergenic
928488182 2:31754094-31754116 CCCAGAAAGACAAATGCAGAAGG + Intergenic
928722019 2:34132080-34132102 CTGGGAGACAGAAATCCAGCGGG + Intergenic
928891947 2:36214693-36214715 CTGAGAAAGACAAAAGGAGGAGG + Intergenic
929022488 2:37567400-37567422 CTGAGAAAGGCAAAGCCATAGGG + Intergenic
930076038 2:47406388-47406410 CTAATAAAGACATACCCAGCTGG - Intronic
933444379 2:82359879-82359901 CACAGAAAGACAAATACTGCAGG - Intergenic
934075973 2:88429101-88429123 CTGAGATAGGCAAATCAGGCAGG - Intergenic
934672962 2:96227997-96228019 CTGAAAAATACAAAACTAGCCGG - Intergenic
935137497 2:100321196-100321218 CTGGAAAAGACAAAACCAGTGGG + Intronic
935219882 2:101002982-101003004 GTCAGAAAGACCAATGCAGCTGG - Intronic
935459462 2:103311579-103311601 CTGAAAAAGTCAAATCCATAAGG - Intergenic
935671115 2:105557881-105557903 TAGAAATAGACAAATCCAGCTGG + Intergenic
936969523 2:118163883-118163905 CTGATAAAGACATACCCGGCCGG - Intergenic
937546302 2:123025300-123025322 CTGAGAAAAAGCATTCCAGCGGG + Intergenic
938177332 2:129145525-129145547 CACAGAAAGACAAATACTGCAGG - Intergenic
939189100 2:138895477-138895499 TGGAGAAAGACCATTCCAGCTGG + Intergenic
942011726 2:171769827-171769849 CAGAAAAGGACAGATCCAGCAGG + Intergenic
942109647 2:172667534-172667556 CTGGGAAGGACAAATCCTCCAGG + Intergenic
942490944 2:176489452-176489474 ATGAGAAAAACAAGACCAGCAGG + Intergenic
944086772 2:195857347-195857369 CTGATAAAAAGAAATCCAGCTGG - Intronic
944430932 2:199632990-199633012 CAAAGAAATACAAATACAGCTGG + Intergenic
944670333 2:201989212-201989234 CTGAGAAAGAGCAGTCCAGGTGG + Intergenic
946710518 2:222500318-222500340 CTGAAAACGAGACATCCAGCTGG - Intronic
947768292 2:232651377-232651399 CTGGGAAAGGCAAATGCAGGTGG - Intronic
948567471 2:238896082-238896104 CTGAGAAGGAGGAATCCTGCTGG - Intronic
1169319001 20:4615867-4615889 CTGAGAAAGATCAACCCTGCCGG - Intergenic
1170009829 20:11710653-11710675 CTGAGAAAGAAAAACGAAGCTGG + Intergenic
1170617296 20:17964243-17964265 GTGAGGAATACAAATCCAGATGG - Intronic
1170947247 20:20902240-20902262 CTCAGAAAGCCAAATCCTGATGG - Intergenic
1171252537 20:23660296-23660318 CTGAGAAAGCCCAGCCCAGCTGG - Intergenic
1171383237 20:24749163-24749185 CTGAGAAAGACAATCAAAGCAGG + Intergenic
1171420935 20:25017255-25017277 TTGAGAAATACAAATCTAGGGGG + Intronic
1171441058 20:25163376-25163398 CACAGAAAGACAAATGCGGCAGG - Intergenic
1172834920 20:37867178-37867200 CTGAGAAAGGAAAATCCTTCAGG - Intronic
1173080298 20:39860795-39860817 TTGAGAAAGACAAATACACAGGG + Intergenic
1173328578 20:42055485-42055507 CTTAGAAAAACAAATACTGCTGG - Intergenic
1174545710 20:51323648-51323670 ACAAGAAAGACAAATCCAGTTGG + Intergenic
1174642795 20:52059669-52059691 CAGAGAAGGAAAAAACCAGCAGG + Intronic
1175625318 20:60484482-60484504 CTGAGAAAGGCGAAGCCATCAGG + Intergenic
1175840904 20:62026647-62026669 CGCAGAAACACGAATCCAGCAGG + Intronic
1176174578 20:63713525-63713547 CTAAGGAAAACAACTCCAGCCGG - Intronic
1176448308 21:6840674-6840696 CTGGAAAAGACAAAACCAGTGGG - Intergenic
1176826478 21:13705696-13705718 CTGGAAAAGACAAAACCAGTGGG - Intergenic
1177306472 21:19324572-19324594 CTGAGATAAACAAAATCAGCAGG + Intergenic
1177555684 21:22685203-22685225 TTGAGAAAAACAAACCCATCAGG - Intergenic
1177970681 21:27785808-27785830 GTGAGAAAGAAAAATAAAGCAGG - Intergenic
1178009234 21:28263860-28263882 AGGAGAATGACAAATCCAGGAGG - Intergenic
1178254851 21:31043148-31043170 ATCAGAAAAACAAATGCAGCTGG + Intergenic
1178459314 21:32787817-32787839 CATAGATAGACAAATACAGCAGG - Intergenic
1178695322 21:34787777-34787799 CAGAGAAAGACAAAACCAATTGG + Intergenic
1179589802 21:42399309-42399331 CGGAGAAAGACAAATACTGCAGG + Intergenic
1179626320 21:42651490-42651512 CTAAAAAAGAAAAATCCTGCGGG - Intergenic
1180912921 22:19465556-19465578 CTGAGAAAGACAGATCTATGAGG + Intronic
1183344179 22:37298038-37298060 CTGTGGAATACAAATCGAGCAGG + Intronic
1183445242 22:37849298-37849320 CTGAGACAGCCATATCCAGAAGG - Exonic
1184615594 22:45636050-45636072 CTTATAAAGAAGAATCCAGCCGG - Intergenic
1184742360 22:46436347-46436369 CTAGGAATGACAAGTCCAGCCGG + Intronic
951380350 3:21976695-21976717 CTGAGAAATAATAAACCAGCTGG + Intronic
951589806 3:24251703-24251725 CTGAAAATGCCAAATCCAGATGG + Intronic
952990342 3:38826171-38826193 CTGAGAAACACAGTCCCAGCCGG - Intergenic
953160463 3:40414992-40415014 CTAAGAAAGACATATATAGCTGG + Intronic
954585356 3:51730764-51730786 CTGAAATGGACAAAACCAGCAGG - Intergenic
954611514 3:51946947-51946969 CTGCTACAGACAAGTCCAGCTGG - Intronic
955300053 3:57769487-57769509 CTTAAAAAAAAAAATCCAGCCGG - Intronic
955913853 3:63886147-63886169 CACAGAAAGACAAATACTGCAGG + Intronic
957391525 3:79578790-79578812 CTGAGAAAGACACTTCCATTTGG + Intronic
959174800 3:102893627-102893649 CATAGAAAGACAAATACTGCAGG + Intergenic
959822537 3:110753641-110753663 CAGAGGGAAACAAATCCAGCTGG + Intergenic
960144263 3:114182745-114182767 CTGAAAAAGACAAATATAGTAGG - Intronic
961501086 3:127336634-127336656 CTGAGAAAGACAAAGAAAGGGGG - Intergenic
962450836 3:135515696-135515718 CTGAGAAAGACAAATAAAATGGG + Intergenic
963634603 3:147778272-147778294 CTGGGAAAGAGAAATACAGTTGG - Intergenic
964751036 3:160054136-160054158 ATGAAAATGAGAAATCCAGCTGG + Intergenic
965165276 3:165188832-165188854 CTGAGAAAAACAGAACCAGCAGG + Exonic
965729752 3:171758738-171758760 CTGATACAGCCAAAGCCAGCTGG - Intronic
965816303 3:172640378-172640400 CTGAGTGAGACAACTCCAGAGGG + Intronic
967202460 3:187084398-187084420 GTGAGAAAGAAAAATACATCCGG + Intergenic
969258274 4:6017747-6017769 CAGAGGCAGACAAATCCAGTTGG - Intergenic
969414336 4:7048813-7048835 CAGAAAAGGACAAATCCTGCAGG - Intronic
970422356 4:15917007-15917029 CTGAGACAGGCATATACAGCTGG + Intergenic
970697164 4:18691699-18691721 CTGTGAAGGACCAACCCAGCAGG - Intergenic
972244235 4:37227580-37227602 CTGTGACAGATAAATCCAGGAGG - Intergenic
972295827 4:37736678-37736700 CTGAGATAGACCAAGCCACCAGG - Intergenic
974723658 4:65773121-65773143 CAGAGAAAGACAGATCCCACTGG - Intergenic
976100530 4:81558063-81558085 CTTTGAAACAGAAATCCAGCTGG + Intronic
976779332 4:88740715-88740737 TTGAGAAAGACAAATACAAAAGG - Intronic
976806171 4:89050028-89050050 CTGAGAAAGACAAATAGTACAGG + Intronic
977343583 4:95791141-95791163 CTGAGAGAGAGAAAGCCAGGTGG - Intergenic
978055497 4:104259185-104259207 CTGAGAAAGACAAATCTGTGAGG + Intergenic
978665847 4:111181416-111181438 CTGAAATAGACAGATCCAACAGG - Intergenic
979682154 4:123473044-123473066 CTTCAAAAGAAAAATCCAGCCGG - Intergenic
980433656 4:132739361-132739383 TTGACAAAGACAAATGCAGTAGG + Intergenic
981722156 4:147812494-147812516 CTGAGGAACACAAAGCCAACAGG - Intronic
982425948 4:155260516-155260538 CTGAGCAAGAAGAATACAGCTGG - Intergenic
982665300 4:158253524-158253546 CTAACAATGACAAAACCAGCAGG + Exonic
982685526 4:158484221-158484243 ATTAGAAAGACAAATACAGGTGG + Intronic
983409650 4:167380333-167380355 ATAAGAAAGAAATATCCAGCGGG - Intergenic
983572626 4:169226284-169226306 CTGTGAAAGACAAACCAAGTGGG - Intronic
984079038 4:175219840-175219862 CTGAGAAAGAAAAAGAAAGCTGG - Intergenic
985481380 5:113098-113120 CTGAGAAAGACAAAATGTGCAGG - Intergenic
986043320 5:4013539-4013561 GTGAGAAAGATAAATCGGGCCGG + Intergenic
986853551 5:11841599-11841621 GTGAGAAAGAGAAATGAAGCAGG + Intronic
988826766 5:34944175-34944197 CTGAGACAGACATTGCCAGCAGG + Intronic
988832486 5:35001430-35001452 CTGAGGAAGACAAATCTAAGGGG - Intronic
988887687 5:35576067-35576089 GTGTAAAAGACAAATACAGCAGG - Intergenic
989420402 5:41232417-41232439 CAGAGAAAGAAAAATCCATGTGG - Intronic
989484611 5:41975272-41975294 TATAGAAAGACAATTCCAGCAGG - Intergenic
991437856 5:66614848-66614870 CAGAGAAAAACATCTCCAGCAGG - Intronic
992575928 5:78112136-78112158 CTGAGACAGAAAAATACAGGGGG + Intronic
992855667 5:80858769-80858791 CTGAAACAGACAGATCCAGCAGG - Intronic
993093577 5:83456996-83457018 CACAGAAAGACAAATACTGCAGG + Intergenic
993965684 5:94357588-94357610 CTGTGAAAGTCACATCCAACAGG - Intronic
994276042 5:97839068-97839090 TATAGAAAGACAAATCCATCTGG + Intergenic
997688576 5:135809686-135809708 CTGGAAAAGACAAATCCACATGG - Intergenic
1001476801 5:172056363-172056385 CTGAGACAGACAATTCCCGCAGG + Intronic
1002495326 5:179607704-179607726 CAGAGAAAGGGGAATCCAGCGGG - Intronic
1002597984 5:180336524-180336546 CAAAGAAAGACACATTCAGCTGG - Exonic
1002842954 6:921947-921969 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1004251145 6:14024117-14024139 AAGACAAAGACAAACCCAGCAGG - Intergenic
1004705248 6:18118461-18118483 TTGAGAAAGCCAAGTCCAGGCGG + Intergenic
1004792934 6:19048920-19048942 CAGAAATAGAGAAATCCAGCAGG - Intergenic
1005159391 6:22841511-22841533 CTGAGAAAAAAGAATACAGCTGG + Intergenic
1005228313 6:23669726-23669748 CTGAAACATACAGATCCAGCAGG - Intergenic
1006465957 6:34195122-34195144 CTGAGAAGCAGAAATCCAGAGGG + Intergenic
1006671039 6:35729839-35729861 TTGAGAAAGATTATTCCAGCAGG - Intergenic
1010006951 6:71006054-71006076 CTGAGAAAGAAAAATAAAGTTGG - Intergenic
1010305084 6:74310372-74310394 CTGAGAAAGAGAATGCCACCTGG - Intergenic
1010877894 6:81130999-81131021 CTCAGGAAGACTAATCCAGAGGG + Intergenic
1011197578 6:84797856-84797878 CTGGGAAAAACAAATCAGGCAGG + Intergenic
1011411831 6:87074364-87074386 CTGAGTGAGAAAAAGCCAGCTGG - Intergenic
1011747706 6:90422370-90422392 CTGAAAAATACAAAATCAGCCGG - Intergenic
1016262382 6:142187853-142187875 CTGATAAGTACAAATGCAGCAGG - Intronic
1017105981 6:150888359-150888381 CTGAGAACACCAAATACAGCAGG + Intronic
1017555048 6:155555179-155555201 GTCAGAAAGACAAGCCCAGCAGG - Intergenic
1021505760 7:21383083-21383105 CTGAGAAAGAAAAATGCAAATGG + Intergenic
1023992118 7:45134558-45134580 CTGAGAAGGGAAAGTCCAGCAGG + Intergenic
1026410391 7:70115295-70115317 ATGAGAGATACATATCCAGCTGG - Intronic
1028798146 7:94928662-94928684 CTTAGAAAGACAAATAAAGAGGG - Intronic
1030201130 7:106905957-106905979 CTGAGACACACAAACACAGCAGG + Exonic
1030775691 7:113531163-113531185 CTGAGAAAGACAAGAACAGGAGG + Intergenic
1031329330 7:120444417-120444439 AAGAAAAAGACAAATCTAGCTGG - Intronic
1033073443 7:138225880-138225902 CTGAGAATGAGAAATCCTGGAGG - Intergenic
1035567906 8:653939-653961 CACAGAAGGACAAATCCCGCAGG + Intronic
1035928864 8:3759486-3759508 ATTAGAAAACCAAATCCAGCAGG - Intronic
1036775653 8:11611089-11611111 CAGAGAAAGACAAATATTGCAGG + Intergenic
1037580617 8:20243977-20243999 ATGGGAAAGACCATTCCAGCTGG - Intergenic
1038523953 8:28257361-28257383 GAGAGAAGGCCAAATCCAGCAGG + Intergenic
1043001916 8:74770005-74770027 ATGAGTAAGAAAAATCCAGCTGG + Intronic
1043088625 8:75869746-75869768 CTGAAAAGGACAAATAAAGCAGG - Intergenic
1043412824 8:80016876-80016898 CAGAAAAGGACAGATCCAGCAGG + Intronic
1044506985 8:93033092-93033114 ATAAGAAATACAAAACCAGCTGG - Intergenic
1046058598 8:109108798-109108820 CTGAGAAAGAAAAACTCAACTGG - Intronic
1046469072 8:114644559-114644581 CTGAGAAAGACAATTGCAGCTGG + Intergenic
1046606836 8:116381084-116381106 CTAATAAAGACACACCCAGCAGG + Intergenic
1048418112 8:134249667-134249689 CTAGGAATGACAAATTCAGCAGG - Intergenic
1048771679 8:137902202-137902224 GAGAGAAAGACAAGTCCAGGTGG - Intergenic
1049090483 8:140510720-140510742 CTTAGAAAAAAAAATCCAACAGG + Intergenic
1049807027 8:144545811-144545833 CTGAGAAGGACAAATGCGGCTGG + Intronic
1050681583 9:8117702-8117724 CTGATAGATACAAATCCAGCAGG + Intergenic
1051046013 9:12874475-12874497 TTGAGAAAGAAGAATACAGCTGG + Intergenic
1051604254 9:18905151-18905173 CTGTGAAATACAAAAGCAGCAGG - Intronic
1052030032 9:23618230-23618252 CTGAGCTAGACAAATCCTGGAGG + Intergenic
1052229425 9:26130613-26130635 CAGAGAAATACAAATGCAGAAGG + Intergenic
1052235731 9:26211755-26211777 CTGAGAAACAAAAATCAACCAGG - Intergenic
1052668567 9:31526044-31526066 CAGAGAAAGAAAAACCAAGCTGG + Intergenic
1055911782 9:81361466-81361488 CTGAGAAAGACAAGCACAGCTGG - Intergenic
1059915769 9:119098284-119098306 CACAGAAAGATAAATCCTGCAGG + Intergenic
1060236372 9:121866361-121866383 TTGAAAAAGAAAAATCCGGCCGG + Intronic
1203520883 Un_GL000213v1:43844-43866 CTGGAAAAGACAAAACCAGTGGG + Intergenic
1186336045 X:8589809-8589831 CTGGGACAGAGAAATTCAGCAGG - Intronic
1187178473 X:16918679-16918701 CATAGAAAGACAAATACCGCAGG + Intergenic
1187853370 X:23613308-23613330 CTGATAAAAACATACCCAGCTGG + Intergenic
1187949575 X:24458561-24458583 CTGAAAAAGCCACATCCTGCAGG + Intergenic
1188554637 X:31398365-31398387 CTGAGAAAGACATAGCGAGAGGG + Intronic
1189048755 X:37621131-37621153 CTGAGATATCCAAATCCAGATGG - Intronic
1192569405 X:72190653-72190675 TTAAGAAAGAAAAATTCAGCCGG + Intronic
1192631147 X:72778552-72778574 CTGAGAAAGACAAATAGAACTGG - Intronic
1192650562 X:72942249-72942271 CTGAGAAAGACAAATAGAACTGG + Intronic
1192771609 X:74197931-74197953 CTGAGAAAAAAAAATCCTGGAGG - Intergenic
1195688324 X:107604399-107604421 CTTAGAGAGACAAATCCACAGGG - Exonic
1196143066 X:112286621-112286643 CTTAGATAGACAAATCCAGTTGG - Intergenic
1197275420 X:124473658-124473680 CTGAGAAAGACAAGCCTAGGTGG - Intronic
1197841362 X:130750772-130750794 CAGAGAAAGACAGATACAGAGGG - Intronic
1199010361 X:142750970-142750992 CACAGAAAGACAAATACTGCAGG - Intergenic