ID: 1082853502

View in Genome Browser
Species Human (GRCh38)
Location 11:57786064-57786086
Sequence GCCATTAAGTCCTACATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082853502_1082853506 25 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853506 11:57786112-57786134 TCAGAAAATCTAGTCTTAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 186
1082853502_1082853503 -3 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853503 11:57786084-57786106 GGCTTATTGAGAGTAAAACTAGG 0: 1
1: 0
2: 1
3: 8
4: 130
1082853502_1082853504 23 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853504 11:57786110-57786132 TCTCAGAAAATCTAGTCTTAAGG 0: 1
1: 0
2: 3
3: 37
4: 233
1082853502_1082853507 26 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853507 11:57786113-57786135 CAGAAAATCTAGTCTTAAGGGGG 0: 1
1: 0
2: 16
3: 22
4: 137
1082853502_1082853505 24 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853505 11:57786111-57786133 CTCAGAAAATCTAGTCTTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082853502 Original CRISPR GCCATTAAGTCCTACATTAC TGG (reversed) Intronic
905540006 1:38753007-38753029 GCCATCAATTCCTACTTTACAGG - Intergenic
909962725 1:81866987-81867009 GCAAGTAAGTGCTTCATTACTGG + Intronic
912920568 1:113862620-113862642 GCCTTGAAGGACTACATTACTGG + Intronic
918445354 1:184611757-184611779 GCAGTTAAGTCCCACAGTACAGG + Intronic
918579164 1:186105007-186105029 GCCTTTAAGACCTACAGTAATGG - Intronic
921456467 1:215377939-215377961 GGAATTAAGTCCTGAATTACTGG - Intergenic
1070659418 10:78293923-78293945 GCCATGGAGTGCTACATTTCTGG + Intergenic
1074839415 10:117334224-117334246 GGCATGAAGCCCAACATTACAGG - Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1088316432 11:108511471-108511493 GCCCCTAGCTCCTACATTACAGG - Exonic
1090447001 11:126773073-126773095 GCCATTAGCTCCTAAAATACTGG + Intronic
1092708238 12:11308223-11308245 GTCATTGAATCCTAGATTACTGG + Exonic
1094785625 12:33845681-33845703 GCCATTAAGTCATATAATACTGG + Intergenic
1099147979 12:79071793-79071815 GGCCTTAAGTCCAACATAACTGG - Intronic
1104240972 12:126989229-126989251 GTCATTCAGACCTACAGTACAGG + Intergenic
1106586339 13:31059436-31059458 GACATTAACTTCTTCATTACCGG + Intergenic
1109360183 13:61285143-61285165 GCCATAAAGTCTTACACTTCAGG - Intergenic
1111487388 13:88921523-88921545 GCCATTGAGTGCTACTTTCCAGG - Intergenic
1114761349 14:25318973-25318995 GCCATTAATGCCTACATCAAAGG - Intergenic
1119753121 14:77094832-77094854 GCCCTTAAATCCTACATTTAGGG - Intergenic
1131748926 15:95484533-95484555 GCCATAATTTCCTCCATTACTGG - Intergenic
1135720378 16:24812468-24812490 GCCATTAAGTGGTGCATGACTGG - Intronic
1147307126 17:39571945-39571967 GGCATTAATACCTACATTTCAGG - Intergenic
1154969989 18:21398303-21398325 GCCATTAACGCCTACCTTGCCGG + Intronic
1156067020 18:33155831-33155853 AACATAAAGTCCTACATTACTGG + Intronic
1159288117 18:66379003-66379025 AACATTAACTCCTACATTAGAGG - Intergenic
1159548152 18:69866784-69866806 GCCTTTAAGTCCAAGATAACTGG + Intronic
1162713251 19:12611484-12611506 GCCATTAATCCCTAGATTTCCGG + Intronic
1164963143 19:32454255-32454277 TCCATTAATTCCTACACCACGGG - Intronic
926689192 2:15721245-15721267 GCCTTCAAGACCTACATTTCTGG - Intronic
927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG + Intronic
938739063 2:134213875-134213897 TCCATGAAGTCCCACATGACAGG - Intronic
944541888 2:200761931-200761953 GACATTGAGTGCTACATTAACGG + Intergenic
945325723 2:208480210-208480232 GCCATCAAGTCCTGCAGTCCTGG - Intronic
1173093954 20:40006188-40006210 GTCATTAAGTCATAAATAACAGG - Intergenic
1179100951 21:38355338-38355360 GCCAAGAAGACCTACATTTCAGG - Intergenic
950816883 3:15713641-15713663 GACAGTAAGTCCTATATTGCAGG - Exonic
951922347 3:27870344-27870366 GCAATTAATTCCTACAATAAGGG + Intergenic
952392623 3:32893248-32893270 GACATTACATCCTACATTTCAGG - Exonic
964419573 3:156487145-156487167 ACCATTAAGTCCAATATAACTGG + Intronic
969478909 4:7436574-7436596 GCCAAGAAGTCCTTCATTATCGG - Intronic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
980313846 4:131170089-131170111 GTCATTGAGTCTTATATTACTGG - Intergenic
981417262 4:144507778-144507800 ACCATTCAGTCCTACCTTATGGG + Intergenic
984531031 4:180916496-180916518 CACATTAAGTCCTAAATTAATGG + Intergenic
989105256 5:37857168-37857190 GCCACCAATTCCTACATTGCTGG - Intergenic
995267267 5:110177097-110177119 GCCATTAAGTTCTACCTATCTGG - Intergenic
997934055 5:138095452-138095474 ACCATTATGGTCTACATTACAGG + Intergenic
1008445000 6:51578553-51578575 GCAATAAAGTCTAACATTACAGG - Intergenic
1016337610 6:143024499-143024521 GCCAGTCAGTCCCAAATTACAGG - Intergenic
1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG + Intergenic
1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG + Intergenic
1020123050 7:5516338-5516360 GCCCTTAAATCCAACATGACTGG - Intergenic
1027448371 7:78300994-78301016 AACATTAATTCCTACATTACAGG - Intronic
1036828755 8:12002910-12002932 GTGATCAAGTCCTAGATTACTGG + Intergenic
1037352661 8:17978156-17978178 GCTATTAAGTTCCAAATTACAGG + Intronic
1192191331 X:68993105-68993127 TCCTGTAAGTCCTACATGACAGG - Intergenic
1193882933 X:86947635-86947657 GCCAGCAAGTCCTACATGGCTGG + Intergenic
1197533271 X:127657382-127657404 CCCATAAACTTCTACATTACAGG + Intergenic
1198082138 X:133250277-133250299 GCCAGTAAGTCCTACAGACCAGG - Intergenic
1200384123 X:155872134-155872156 GTCATTAAGCCCAAAATTACAGG + Intergenic