ID: 1082853502

View in Genome Browser
Species Human (GRCh38)
Location 11:57786064-57786086
Sequence GCCATTAAGTCCTACATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082853502_1082853504 23 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853504 11:57786110-57786132 TCTCAGAAAATCTAGTCTTAAGG 0: 1
1: 0
2: 3
3: 37
4: 233
1082853502_1082853503 -3 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853503 11:57786084-57786106 GGCTTATTGAGAGTAAAACTAGG 0: 1
1: 0
2: 1
3: 8
4: 130
1082853502_1082853505 24 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853505 11:57786111-57786133 CTCAGAAAATCTAGTCTTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 193
1082853502_1082853507 26 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853507 11:57786113-57786135 CAGAAAATCTAGTCTTAAGGGGG 0: 1
1: 0
2: 16
3: 22
4: 137
1082853502_1082853506 25 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853506 11:57786112-57786134 TCAGAAAATCTAGTCTTAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082853502 Original CRISPR GCCATTAAGTCCTACATTAC TGG (reversed) Intronic