ID: 1082853503

View in Genome Browser
Species Human (GRCh38)
Location 11:57786084-57786106
Sequence GGCTTATTGAGAGTAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082853502_1082853503 -3 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853503 11:57786084-57786106 GGCTTATTGAGAGTAAAACTAGG 0: 1
1: 0
2: 1
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082853503 Original CRISPR GGCTTATTGAGAGTAAAACT AGG Intronic
902446662 1:16470336-16470358 AGCTTACTCAGAGTAGAACTTGG + Intergenic
903517674 1:23922938-23922960 GGCTTATAGAGAGTTAGAATGGG - Intergenic
905647406 1:39633986-39634008 GGCTTGTAGAGAGTAAAAGAGGG - Intronic
908865286 1:68541920-68541942 AGCTTGTTGGGAGTAAAAATAGG + Intergenic
909704840 1:78569107-78569129 GGATTCTTTAGAGGAAAACTGGG - Intergenic
909748718 1:79132452-79132474 GTCTTATTGAGAATAGAATTAGG + Intergenic
910389259 1:86721516-86721538 AGCTTATTAGAAGTAAAACTAGG + Intronic
913659168 1:120991484-120991506 GGCTTATTAACAGGAAAAATGGG + Intergenic
913998427 1:143671491-143671513 AGCTTACTCAGAGTAGAACTTGG - Intergenic
914010532 1:143774609-143774631 GGCTTATTAACAGGAAAAATGGG + Intergenic
914167291 1:145186504-145186526 GGCTTATTAACAGGAAAAATGGG - Intergenic
914322921 1:146582741-146582763 GGCTTCTTGAGAGAAGAACCTGG + Intergenic
914508917 1:148313903-148313925 AGCTTACTCAGAGTAGAACTTGG - Intergenic
914649153 1:149683268-149683290 GGCTTATTAACAGGAAAAATGGG + Intergenic
916686098 1:167148414-167148436 GTCTTTTTGAGAGCTAAACTAGG - Intergenic
918463366 1:184797761-184797783 GGCTTAGTGAGATTAAATCTCGG - Intronic
919576309 1:199314052-199314074 GGCTTATGGATTGGAAAACTTGG + Intergenic
920377216 1:205515567-205515589 TGCTAATTGAGAATAATACTTGG - Intronic
921307305 1:213809904-213809926 GGCTTAATGAAAGTAAAGCTGGG + Intergenic
1063047219 10:2404474-2404496 GGTTTATGGACAGTAAAATTAGG + Intergenic
1064593251 10:16916467-16916489 GTTTAGTTGAGAGTAAAACTAGG - Intronic
1073051834 10:100672053-100672075 GGCTTAACGGGAGCAAAACTAGG - Intergenic
1074147418 10:110729208-110729230 GGATTATTGAGGTTAAAATTGGG - Intronic
1077398289 11:2337888-2337910 TGCTTAAGGAGAGTAAAGCTAGG - Intergenic
1078326778 11:10387696-10387718 GGGTTAATGAAAATAAAACTTGG + Intronic
1079959159 11:26901363-26901385 GGCTTCTTGACAGTGAAAATAGG + Intergenic
1082853503 11:57786084-57786106 GGCTTATTGAGAGTAAAACTAGG + Intronic
1087456519 11:98393911-98393933 GTCTCATTGAGTGTACAACTTGG - Intergenic
1088892127 11:114053115-114053137 AGCTAATTGAGAGTATAACTGGG - Intergenic
1094701970 12:32878684-32878706 GGCTTTTTGAAAATAAGACTTGG + Intronic
1098167902 12:67717248-67717270 GCCATGCTGAGAGTAAAACTAGG - Intergenic
1098600467 12:72325272-72325294 GGCTATGTGAGAATAAAACTGGG - Intronic
1099292693 12:80790761-80790783 GGGTTACTGAGAGTTAAAATTGG + Intergenic
1105518990 13:21114642-21114664 GGCCTATTAAGGATAAAACTAGG - Intergenic
1106416295 13:29548787-29548809 GGCTCTTTGAGAATAAAACAGGG - Intronic
1106578420 13:30997509-30997531 GCCTTATTGAGAGGAAATCCAGG - Intergenic
1110739169 13:78974745-78974767 GGCTAACTGAGAGTAAAATAAGG + Intergenic
1113291420 13:108911128-108911150 TGCTTATTGAGAGAACAAATTGG + Intronic
1114058360 14:18996150-18996172 TGCATATTAAGAATAAAACTGGG - Intronic
1114104186 14:19405604-19405626 TGCATATTAAGAATAAAACTGGG + Intronic
1116335039 14:43647153-43647175 GTCTTATTGAGAGTAACAGGAGG + Intergenic
1116759571 14:48994649-48994671 GTATTATTCAGAGAAAAACTGGG - Intergenic
1118919009 14:70132990-70133012 GGTTTATTGAGTGTCAAACCTGG - Intronic
1119514704 14:75239079-75239101 GGATTTTGGAGAGAAAAACTTGG + Exonic
1123554334 15:21411885-21411907 TGCTTATTAAGAAGAAAACTGGG + Intronic
1127677109 15:61250564-61250586 GGCTTATTGAGTGGAATAGTGGG - Intergenic
1131928355 15:97411601-97411623 GGTTTATAGAGAGGAAAACAAGG + Intergenic
1139033637 16:62916552-62916574 GGGTTAATGACATTAAAACTGGG - Intergenic
1139620200 16:68133978-68134000 GGCTGATTGGGAGTATAAATTGG - Intronic
1140010639 16:71128109-71128131 GGCTTCTTGAGAGAAGAACCTGG - Intronic
1144612242 17:16730993-16731015 TGCATATTTAGAATAAAACTGGG - Intronic
1144876043 17:18397951-18397973 GGCATATTCAGAGTATAACCCGG + Intergenic
1144900488 17:18584304-18584326 TGCATATTTAGAATAAAACTGGG + Intergenic
1145131958 17:20361381-20361403 TGCATATTTAGAATAAAACTGGG - Intergenic
1145156185 17:20546469-20546491 GGCATATTCAGAGTATAACCCGG - Intergenic
1146886287 17:36473142-36473164 GGCCAAGTGAGAGAAAAACTGGG + Intergenic
1148014114 17:44508853-44508875 GGCTTCCAGAGAGGAAAACTAGG + Intergenic
1149353790 17:55818560-55818582 GGGTTATTGTGAGTATTACTAGG + Intronic
1151150300 17:72079379-72079401 AGCCTATTGAGATCAAAACTAGG - Intergenic
1153753197 18:8254481-8254503 TGCTTACTCAGAGTAAAAATAGG + Intronic
1154179729 18:12123351-12123373 TGCATATTAAGAGTAAAACTGGG - Intronic
1157105873 18:44773772-44773794 GGCTGGTTGAGATTAATACTTGG - Intronic
1159097484 18:63920727-63920749 GGCTTTTTGATCCTAAAACTAGG - Intronic
1160166835 18:76520994-76521016 GTCTTATTCTCAGTAAAACTGGG + Intergenic
1161390186 19:4016678-4016700 GGCTTCTTGAGAGTCACCCTCGG - Intronic
1164404874 19:27935931-27935953 TCCTTACTGAGAGTAGAACTAGG + Intergenic
1165325854 19:35114445-35114467 GGCTTCTGGAGAGGGAAACTGGG - Intergenic
1166602086 19:44105176-44105198 GTTTGCTTGAGAGTAAAACTAGG - Intronic
1167839090 19:52099201-52099223 GGTTTATTTGTAGTAAAACTAGG - Intergenic
926373570 2:12204554-12204576 AGGTGAGTGAGAGTAAAACTAGG + Intergenic
926503152 2:13679397-13679419 TGCTTAAGGAGGGTAAAACTAGG - Intergenic
929331800 2:40691269-40691291 TGCTGATTTAAAGTAAAACTAGG + Intergenic
933133081 2:78698057-78698079 AGCTTATTGGGAGGAAAACCTGG - Intergenic
934604776 2:95686384-95686406 GGATTATGCAGAGTAAATCTTGG - Intergenic
936538224 2:113328912-113328934 GGATTATGCAGAGTAAATCTTGG - Intergenic
936660899 2:114542428-114542450 GGCTGATTGAGTGGAACACTTGG + Intronic
938282845 2:130078067-130078089 TGCATATTAAGAATAAAACTGGG + Intronic
938432768 2:131260838-131260860 TGCATATTAAGAATAAAACTGGG - Intronic
938476773 2:131623092-131623114 TGCATATTAAGAATAAAACTGGG - Intergenic
943209374 2:184943286-184943308 GACTTATTTGGAGTAAAAATAGG - Intergenic
944103004 2:196049195-196049217 AGATTAGGGAGAGTAAAACTAGG - Intronic
944775728 2:202962555-202962577 GGGTTAAGGAGATTAAAACTAGG - Intronic
946124791 2:217553114-217553136 GGGCTATTGAGAGCAACACTGGG - Intronic
948030186 2:234811272-234811294 AGGTGATGGAGAGTAAAACTGGG + Intergenic
1175116531 20:56686568-56686590 GACTTTTTGATAGTGAAACTGGG + Intergenic
1180476848 22:15718769-15718791 TGCATATTAAGAATAAAACTGGG - Intronic
1180566973 22:16678435-16678457 TGCATATTAAGAGTAAAACTGGG + Intergenic
952712378 3:36444371-36444393 GCCTGAGTGAGAGTAAAACATGG - Intronic
955488217 3:59456412-59456434 GGCCTATAGAGAGTACTACTTGG - Intergenic
956498774 3:69859068-69859090 GCCTTACCCAGAGTAAAACTAGG + Intronic
959627773 3:108472029-108472051 AGGTTGTTGAGAGCAAAACTGGG - Intronic
961579983 3:127873087-127873109 TGTTTGTTGAGAGCAAAACTAGG + Intergenic
963159283 3:142133848-142133870 GGCTTAGTGGGACTAAAAATAGG + Intronic
966816335 3:183892981-183893003 GGGTTATTGAGAGCAAAACTGGG + Intergenic
969644020 4:8416023-8416045 GGCTTATTTGGAGTAAAAGATGG + Intronic
974732295 4:65884125-65884147 GACTTTTTGAGAGTAGAAATTGG + Intergenic
975964659 4:79956823-79956845 TGCTTCTTGGGAATAAAACTTGG - Intronic
978742475 4:112152786-112152808 GGCTAATAAAGAGTAAAACCGGG - Intronic
980954682 4:139415973-139415995 GGATAAGTGAGAGTAAAAATAGG + Intronic
982048834 4:151478512-151478534 TGCTTATTGAGTGTCAGACTTGG + Intronic
987551981 5:19394808-19394830 GGCTTACTAATAGTAAAACAGGG + Intergenic
987685317 5:21191509-21191531 GGATTAATAAGAGTAAAAGTGGG + Intergenic
988479135 5:31614797-31614819 GGCTTATACAGGGCAAAACTGGG - Intergenic
989265438 5:39467940-39467962 GTCTTATTCAGAGTTAAGCTTGG + Intergenic
992827701 5:80567307-80567329 GCCTTAATGAAAGGAAAACTGGG - Intronic
994669633 5:102751638-102751660 GTATTTTTGAAAGTAAAACTGGG + Intergenic
994876312 5:105426780-105426802 GACTTTATGAGAATAAAACTTGG + Intergenic
996048477 5:118904854-118904876 GGCTTTGTGAGAGTGACACTGGG + Intronic
998933570 5:147208861-147208883 GGCTTATTTTGAGTAAAAACTGG - Intergenic
999956291 5:156706313-156706335 GGCTTTTGGACAGTAAAAGTTGG + Intronic
1000188472 5:158884813-158884835 TGCTTATTGACAGGAAAAGTAGG + Intronic
1000871895 5:166587647-166587669 AGTATATTGAGAGTAAAATTTGG - Intergenic
1005232663 6:23722314-23722336 GGCTTGTTGAGAGTGTAAATTGG - Intergenic
1007867964 6:44994642-44994664 GCCTTTTTAAGAGTAAATCTTGG + Intronic
1012488569 6:99751227-99751249 GCCTGATTGAGAATAAAATTTGG - Intergenic
1015884863 6:137906466-137906488 GGCTTCTTGAGAAAAAAACTGGG + Intergenic
1016752150 6:147642730-147642752 GGATTATTTATAGTAAGACTGGG - Intronic
1017155342 6:151317957-151317979 GGCTGCTTGAGAGCAAACCTTGG - Intronic
1020391910 7:7667226-7667248 GGGTTTTTGAGAATAAAATTTGG + Intronic
1020465386 7:8472727-8472749 GTCTTATAAAGAGTTAAACTAGG + Intronic
1026108780 7:67441854-67441876 TGCTTATTGAGAGCAATACTTGG + Intergenic
1028463386 7:91121325-91121347 GGCTGAAGGAGACTAAAACTGGG + Intronic
1037203266 8:16283863-16283885 GGCTTATGGAGAGGAAACCCAGG + Intronic
1039536311 8:38317132-38317154 GGCTGAGTGAGAGTAGCACTTGG + Intronic
1040087434 8:43360052-43360074 TGCATATTAAGAATAAAACTGGG - Intergenic
1041531485 8:58873044-58873066 TGACTATTGGGAGTAAAACTGGG - Intronic
1042827707 8:72995179-72995201 AACATATTGAGAGTACAACTGGG - Intergenic
1043118812 8:76295049-76295071 AGGTTATTTAGAATAAAACTTGG + Intergenic
1044347029 8:91117350-91117372 GGATTTTTAAGACTAAAACTTGG + Intronic
1047444678 8:124908835-124908857 TGCTTAAAGAGGGTAAAACTAGG - Intergenic
1047876318 8:129141620-129141642 GCCTTATTTAGAATAAAACATGG - Intergenic
1048698529 8:137056803-137056825 TCTTTATTGAGAGTAAAACATGG - Intergenic
1049349692 8:142157890-142157912 GGCTTCCTGACAGTGAAACTGGG - Intergenic
1051581160 9:18676216-18676238 GTCCTATTGAGAGGAAAAATAGG - Intronic
1056574603 9:87845641-87845663 GTCTTATGGAAAGTAAACCTAGG + Intergenic
1187181772 X:16949296-16949318 TGCTTATTAAGAGGAAAACCTGG - Intronic
1187684409 X:21802072-21802094 GGTGTATTGAGAGTCAAAGTGGG - Intergenic
1190847051 X:54203583-54203605 GTTTTATAGACAGTAAAACTGGG + Intronic
1200297546 X:154937140-154937162 GACTTCTTGAGATTAAAACTTGG - Intronic
1201382794 Y:13402511-13402533 GGCTTCATGAGAGCAAAATTTGG - Intronic