ID: 1082853504

View in Genome Browser
Species Human (GRCh38)
Location 11:57786110-57786132
Sequence TCTCAGAAAATCTAGTCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082853502_1082853504 23 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853504 11:57786110-57786132 TCTCAGAAAATCTAGTCTTAAGG 0: 1
1: 0
2: 3
3: 37
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082853504 Original CRISPR TCTCAGAAAATCTAGTCTTA AGG Intronic
905245786 1:36612334-36612356 TCTCAGACAAACGAGTCTAAAGG - Intergenic
906384395 1:45354881-45354903 TATAAGAAAATATAGGCTTATGG + Intronic
908098741 1:60768500-60768522 TCTCTGAAAATCTTGTTTGAGGG + Intergenic
908934581 1:69358923-69358945 TCTCAGAAGATCTAATCTTAGGG + Intergenic
909576069 1:77177753-77177775 TTTCAGAAGATCCAGTCTTTGGG - Intronic
911627198 1:100137709-100137731 TCATAGAAAATCGAGACTTATGG + Intronic
912164544 1:107027509-107027531 TCTCATAAAATCCAGGATTATGG - Intergenic
913173307 1:116251650-116251672 TATCCCAAATTCTAGTCTTATGG + Intergenic
913569314 1:120104433-120104455 ACTCAGAAGATCTAATTTTATGG + Intergenic
914290124 1:146265424-146265446 ACTCAGAAGATCTAATTTTATGG + Intergenic
914381572 1:147121134-147121156 CCTCATAAAATCTAGGCTGAGGG - Intergenic
914551167 1:148716207-148716229 ACTCAGAAGATCTAATTTTATGG + Intergenic
915878497 1:159640232-159640254 TCTAAGAAAATGGAGTTTTAAGG - Intergenic
916035305 1:160916695-160916717 TCTCAGAAGATCCAATCTTTGGG + Intergenic
917608908 1:176666495-176666517 TCTCAGAAAACCTCATCTTGTGG + Intronic
918465264 1:184815296-184815318 TTTCAGAAGATCTAATCTTCAGG - Intronic
918696818 1:187555191-187555213 TCTCAGGAATTCTAGTGTTGAGG - Intergenic
921235563 1:213124143-213124165 TCACAGAAATTCAAGTCTCAGGG - Intronic
921518432 1:216127366-216127388 TTTCAGAAAATATATTCTAAAGG - Intronic
922338791 1:224639043-224639065 GCTCAGGAAATGTATTCTTATGG + Intronic
923355433 1:233150318-233150340 TCTCAGAATATCTACTCTCCAGG + Intronic
1063524274 10:6770008-6770030 ATTCAGAAAATCTAGTCACATGG + Intergenic
1064444997 10:15385198-15385220 TCACAGAAAGTCTAGTCTTCTGG - Intergenic
1064565240 10:16633013-16633035 GCTGAGAAACTCTAGTCTAAAGG - Intronic
1064719084 10:18210002-18210024 TCTCTGAAAAATTAGTCTTAAGG - Intronic
1065539861 10:26752536-26752558 TCTTAGAAAATCGAATCTTTAGG - Intronic
1068068113 10:52158712-52158734 TTTCAGAAAATGTATTCTTTTGG + Intronic
1069061138 10:63895695-63895717 TCTCAGATAAATTAGTCTTTGGG - Intergenic
1071894670 10:90052683-90052705 TCGCAGAGAATATAGTGTTAGGG - Intergenic
1075542741 10:123329201-123329223 TCTCAGCAGATCTGCTCTTAGGG + Intergenic
1079359684 11:19760027-19760049 TCTCAGAAAATAGAGTCAAATGG - Intronic
1079508557 11:21183389-21183411 TTTCAGAACATCTATTCATAGGG + Intronic
1080177121 11:29378395-29378417 TTTCAGAAAATTTAGATTTAAGG - Intergenic
1080368029 11:31599874-31599896 TCTCAGAAAACCCAGTGATATGG - Intronic
1081510146 11:43762488-43762510 TGTCAGAAAATAGAGTCTTTAGG - Intronic
1081777154 11:45683425-45683447 TGTCATAAAGTCTAGTCTGATGG + Intergenic
1082689265 11:56279941-56279963 TCTCAAAAGATCCAGTCTTTGGG - Intergenic
1082698415 11:56399248-56399270 TCTCAGAAGATCCAATCTTCAGG + Intergenic
1082853504 11:57786110-57786132 TCTCAGAAAATCTAGTCTTAAGG + Intronic
1087524807 11:99296363-99296385 TCTCAGAAGATCCAATCTTCAGG + Intronic
1090292826 11:125560781-125560803 TCTCAGAAGATCCAGTCTTCAGG - Intergenic
1092012806 12:5129403-5129425 TCTCAGAAAATATATTCTGTTGG - Intergenic
1095168123 12:38998968-38998990 TCTCAGAAATACTAGTTTTAAGG - Intergenic
1096664706 12:53155848-53155870 TCTCAAAAATTCTATTATTAGGG + Intergenic
1096943545 12:55377061-55377083 TATCATAAAATCTATTCTGAAGG - Intergenic
1097254528 12:57663387-57663409 TCTCAGAAGATCCAATCTTCAGG - Intergenic
1105571426 13:21606691-21606713 TGTCAGAAAAACTGCTCTTAAGG + Intergenic
1106292347 13:28375873-28375895 TCTCATGAAATCTATCCTTACGG - Intronic
1110050111 13:70886395-70886417 TCTCAGAAGATCTAATCTTTGGG - Intergenic
1114335069 14:21680623-21680645 TCTCAGAAGATCCAATCTTTGGG - Intergenic
1115153586 14:30313673-30313695 TCTCAGAAAATCTAGTGTTCAGG - Intergenic
1115533450 14:34347899-34347921 TCTCAGAAGATCAAATCTTCAGG + Intronic
1116106845 14:40519447-40519469 TATCAAAAAATGTAGTCTTTTGG - Intergenic
1116234989 14:42268626-42268648 TCTCAGAAGATCCAATCTTTAGG + Intergenic
1116679264 14:47945019-47945041 TCTCAGAAGATCCAGTCCTTAGG - Intergenic
1117304226 14:54458350-54458372 TCTCAGGAAATCTACAATTATGG - Intergenic
1120649729 14:87117894-87117916 TCTCAGAAGATCCAATCTTTTGG - Intergenic
1123888707 15:24753049-24753071 TCTCAGTAAATTTTGTCTTATGG - Intergenic
1124138086 15:27052459-27052481 TCACAGAAAATCTAAGCATAAGG + Intronic
1129843658 15:78758487-78758509 TCCCATAAAATCTAGTCCCATGG - Intergenic
1130258146 15:82335313-82335335 TCCCATAAAATCTAGTCCCATGG + Intergenic
1130596783 15:85254647-85254669 TCCCATAAAATCTAGTCCCATGG - Intergenic
1132278308 15:100589935-100589957 TCTCAGAAGATCTAATCTTTAGG - Intronic
1134918437 16:18093663-18093685 ACTCAGAAAATCTAGACTATTGG + Intergenic
1136154344 16:28373030-28373052 TCTCAGAAGATCCAATCTTCAGG - Intergenic
1136208746 16:28742232-28742254 TCTCAGAAGATCCAATCTTCAGG + Intergenic
1137891313 16:52165560-52165582 TCTCAGCAAATCTAGGTTTGAGG - Intergenic
1138158186 16:54725793-54725815 TCTCATAAAATGAAGTCTTGAGG - Intergenic
1140441658 16:74992523-74992545 TCTCAGAAAATGTCCTGTTATGG - Intronic
1141024864 16:80537006-80537028 TCTCAGATAATCCAGTCTTGAGG - Intergenic
1144106538 17:11991451-11991473 TCTCAAACATTCTAGTCTAAAGG + Intronic
1144227391 17:13162831-13162853 GCTCACAACATATAGTCTTAGGG + Intergenic
1144263002 17:13541541-13541563 TCTCAGAGAAACTGGACTTAGGG - Intronic
1144426624 17:15148946-15148968 TCTCAGAAGATCCAGTCTTCAGG - Intergenic
1144591782 17:16530435-16530457 TCTGAGAAAATCTCTTGTTATGG - Intergenic
1145392043 17:22462616-22462638 TCTGAGAGAATTTAGTCTCAAGG + Intergenic
1145843436 17:28016331-28016353 TCTCAGTCAATCTTGTCTTTTGG - Intergenic
1146755779 17:35430942-35430964 TCTCAGAACATCTACTGTAAAGG - Intronic
1147805139 17:43125863-43125885 CCTTAGAAACTGTAGTCTTATGG + Intergenic
1150008505 17:61484485-61484507 TCTCAGAAAATCTACGCTTCTGG + Intronic
1150236726 17:63599377-63599399 TCTCAGAGAATTTAGTATTACGG + Intergenic
1151566568 17:74901784-74901806 TCTCAGAAAACCGAGGCTCAGGG - Intergenic
1152386017 17:79975230-79975252 TGTCAGGAAAGCTAGTCTTTGGG + Intronic
1153118230 18:1687058-1687080 TCTCAGAAGATCCAATCTTTGGG + Intergenic
1156136163 18:34041209-34041231 ACTAAGAAAATCAAGTCTTGAGG + Intronic
1156574451 18:38298217-38298239 TCTCAGGAAACCTTTTCTTAAGG + Intergenic
1159605951 18:70475372-70475394 TCTTAAAAAATCTACTGTTAGGG - Intergenic
1160114650 18:76066115-76066137 TCCCAGAAAATCTAGGCAGATGG - Intergenic
1164897285 19:31887903-31887925 TCTCAGAGAACCAAGTGTTAAGG - Intergenic
1166239618 19:41481015-41481037 ACTCAGACAATCTAGCCTTCGGG + Intergenic
925324441 2:3006864-3006886 TATCAGAAAATGGAGTCTTTGGG + Intergenic
925514144 2:4661055-4661077 TCTCTATAAATCCAGTCTTATGG + Intergenic
925882774 2:8366928-8366950 TCCCAGAACTTCTAGTCTGATGG + Intergenic
926374463 2:12212679-12212701 TCTCAGAAAAGATATACTTAAGG - Intergenic
927356910 2:22185196-22185218 TCTTAAAAAAGCTTGTCTTATGG - Intergenic
927513139 2:23656995-23657017 TCTGTGAACCTCTAGTCTTAGGG + Intronic
929055035 2:37869315-37869337 TCTCTCAAACTCTGGTCTTAGGG + Intergenic
930362659 2:50401489-50401511 TCTTAGAAATTTTAGTTTTATGG - Intronic
930498469 2:52179403-52179425 TCTCAGAAGACCCAGTCTTTGGG - Intergenic
931161262 2:59693243-59693265 TCTCTTGAAATCTAGTTTTAGGG - Intergenic
931923997 2:67051335-67051357 GCTCAGAACTTCTAGTCTTCGGG - Intergenic
932465155 2:71916785-71916807 TTTCAGAAAATGTAGACTTGTGG + Intergenic
933791311 2:85886104-85886126 TCTCAGAAACTCAATGCTTAAGG + Intronic
935518471 2:104075319-104075341 TATCTATAAATCTAGTCTTAGGG - Intergenic
935708937 2:105880579-105880601 TCTAAGACCATCCAGTCTTAGGG - Intronic
937656741 2:124385507-124385529 CCCCAGAGAATATAGTCTTATGG - Intronic
938628403 2:133137625-133137647 TCTAAGAAAATTTAGTCATATGG - Intronic
939899220 2:147829326-147829348 ACTCAGCAATTCTACTCTTAGGG + Intergenic
942417247 2:175772297-175772319 TCTCATAACAGCCAGTCTTAGGG - Intergenic
942627160 2:177913596-177913618 TCACACAATATCTAGTTTTAGGG + Intronic
943183189 2:184570952-184570974 TGTTAGAAAATCTAGTTTTAGGG - Intergenic
943196808 2:184763561-184763583 TCTCTGAATATCTGGTATTAAGG + Intronic
943216354 2:185041838-185041860 ACTCAGAAAAGCTATTCTTTGGG + Intergenic
945010528 2:205457825-205457847 TTTCAGAAAATTTAGGATTATGG - Intronic
945163866 2:206921429-206921451 TCTCAGAGCATATAGTCTGATGG - Intergenic
946296910 2:218791739-218791761 TCTCAGAAGACCTACTCTTTGGG + Intronic
947517232 2:230816411-230816433 AATCACAAAATCTATTCTTACGG - Intronic
948009591 2:234640600-234640622 TCTCAGAAAATCAAATCTGCTGG - Intergenic
949076264 2:242060570-242060592 TCTTAGAATATCTGGTCTAAAGG + Intergenic
1169120143 20:3090796-3090818 TCTCAGAAAAGGTGGTCTAAGGG - Intergenic
1170248614 20:14253272-14253294 TGTTAGTAAATATAGTCTTATGG + Intronic
1171318560 20:24218456-24218478 TCTCAGAAGATCCAGTGTTTGGG + Intergenic
1172382976 20:34512308-34512330 TCTCAGAAAAGCAATTCATATGG - Intergenic
1174630765 20:51955021-51955043 TCTCAGAAGATCCAATCTTCGGG - Intergenic
1174924689 20:54745997-54746019 ACTCAGCAATTCTACTCTTAGGG + Intergenic
1177326908 21:19602400-19602422 TCTCAGAAGATCCAGTCTTTGGG + Intergenic
1181453781 22:23041955-23041977 TCTCAGAAAATTCAATCTTCAGG + Intergenic
1184618628 22:45656083-45656105 TCCCAGAAGATCCAGTCTTCAGG - Intergenic
1185147887 22:49149243-49149265 CCTCAGAGGACCTAGTCTTAGGG + Intergenic
949213544 3:1536307-1536329 TTTCAGGAAATTGAGTCTTAGGG + Intergenic
949256933 3:2059847-2059869 TCTCAGAAGGTCAAGTCTTAAGG + Intergenic
949502860 3:4698723-4698745 TCTCAGACTGTCTAGTTTTAAGG + Intronic
949962666 3:9326144-9326166 TCTCAGAAGATCCAATCTTTGGG + Intronic
951639806 3:24824667-24824689 TCAAAGAAATTCTAGTCTTTGGG + Intergenic
952288227 3:31988761-31988783 TCTCAGAAAATCTGCTTATAAGG - Exonic
955472825 3:59303723-59303745 TCACAGAAAATGAAGTCATACGG - Intergenic
955846256 3:63166202-63166224 TCTAATAAATTCTGGTCTTAGGG - Intergenic
957376395 3:79364911-79364933 TTTCAGAAAATGTAGTCTTATGG - Intronic
957645141 3:82912630-82912652 TCTCAGAAAATGTAGCTGTAAGG - Intergenic
957719053 3:83970542-83970564 TCTCAGAAGATCCAGTCTTTTGG - Intergenic
957724748 3:84049482-84049504 TCTCAGAAGATCCAATCTTTGGG - Intergenic
957750822 3:84413001-84413023 TCTCAGAAGATCCAATCTTTGGG - Intergenic
959834042 3:110897211-110897233 TGTCAGCACATCTAGTCCTAGGG - Intergenic
960076320 3:113489897-113489919 TCTAAGAAAATACAGTATTATGG - Intronic
960371168 3:116841960-116841982 TTTAAGACAATCTAGTCCTAGGG + Intronic
961596216 3:128019671-128019693 TCTCAGAAGATCCAGTCTTCAGG - Intergenic
963656009 3:148050864-148050886 TCTCAGAAAAAAAAGTATTAAGG - Intergenic
964362303 3:155911324-155911346 TTTAATCAAATCTAGTCTTATGG + Intronic
964571823 3:158115436-158115458 TCTCAAACATTTTAGTCTTAGGG + Intronic
964582262 3:158253543-158253565 TCACAGAAAATTTAATCTAATGG - Intronic
966536260 3:181037645-181037667 TCTCAGAAGATCCAGTCTTCAGG + Intergenic
968375351 4:35823-35845 TGTCAGAAAAGCTATTCCTAAGG + Intergenic
968847061 4:3049674-3049696 TCTCAGAAGATCCAGTCTTCGGG + Intergenic
970636491 4:18015678-18015700 TCTAAGTAAATCTACTCTTATGG + Intronic
971823434 4:31589610-31589632 TCTCAGATATTCTAATTTTATGG + Intergenic
972541198 4:40040942-40040964 TCTGAGCAATTCTATTCTTAAGG - Intergenic
972819137 4:42679491-42679513 TCTCAGAAGATCCAATCTTAGGG - Intergenic
973649382 4:52982927-52982949 TTTCAGAAAATCCATTCTCATGG + Intronic
973813927 4:54600747-54600769 TCTCAGAAGATCCAATCTTTGGG + Intergenic
974795587 4:66744841-66744863 TCTCAGAGATTCTTGTCCTATGG + Intergenic
976050199 4:81002913-81002935 TTGCAGAAAATCTGTTCTTATGG + Intergenic
978019142 4:103786685-103786707 TCTCCCAAGATCTATTCTTAGGG + Intergenic
978950781 4:114556395-114556417 TCTCAGAAGATATAATCTTTGGG + Intergenic
979452345 4:120887327-120887349 TCTCACCAAATCTACTGTTAGGG + Intronic
979877028 4:125905764-125905786 TCTCATAAATTCTAGTTTCAAGG + Intergenic
979993674 4:127405695-127405717 TCTGAGAAAATGTTGTATTATGG + Intergenic
981201247 4:141982285-141982307 TCTCAGAAAATCCAATCTTTGGG - Intergenic
981233885 4:142392048-142392070 TCTCAGAAGATTTGGTCTTTGGG - Intronic
982309793 4:153972994-153973016 TCTCTGAAAATCTTCTCTAATGG + Intergenic
982459609 4:155652300-155652322 TCTCCGGAAATCTAATCGTATGG - Intergenic
983307816 4:166015816-166015838 CCTTAGCAAATCTAGTATTAAGG - Intronic
986650090 5:9954574-9954596 TCTCAGAAAATCTGCTATTTTGG + Intergenic
988320414 5:29687526-29687548 TCTTTGAAAATATAGTCCTAAGG - Intergenic
988863687 5:35311079-35311101 CCTCAGAACATTTAGTCCTATGG + Intergenic
989237276 5:39163131-39163153 ACTTAGAAAATCTAGTTTTACGG + Intronic
989915230 5:49717269-49717291 TCTCATAAAAACTAGACTGAAGG + Intergenic
991201687 5:64001726-64001748 TTTCAGAAAATGAAGTCTTTAGG - Intergenic
992993630 5:82311046-82311068 TCTGAGAAAAAATAATCTTAAGG + Intronic
993122263 5:83790201-83790223 TGTCATAAAATCTAGTATTTTGG + Intergenic
995325557 5:110885842-110885864 TCTCAGAAGATCCAGTCTTCAGG - Intergenic
996422999 5:123282833-123282855 TTCCAAAAAATCTAGTCTTTGGG + Intergenic
998517114 5:142766617-142766639 TCCCAGAAAATCTGCTCATAAGG - Intergenic
1001730442 5:173950868-173950890 TATCATAAAATTTAGTCTTTAGG + Intronic
1006290735 6:33134213-33134235 TCTCAGAAGATCCAATCTTCAGG + Intergenic
1006799330 6:36749943-36749965 CCTGATAAAGTCTAGTCTTATGG + Intronic
1006875565 6:37292412-37292434 TCTCAGAAAATTAAGAATTAAGG + Intronic
1007625760 6:43245411-43245433 TCTCAGAAAGTCATGTCTTCTGG + Intronic
1009293949 6:61919953-61919975 TTTGAGAAAATCTATTTTTATGG + Intronic
1010485208 6:76403109-76403131 TTTCTGAATATCTAGTCTGAAGG + Intergenic
1011945582 6:92898169-92898191 TCCCAGAATATCTCTTCTTATGG + Intergenic
1012135740 6:95553419-95553441 TCTCAGAGAATCTAATCTGCAGG - Intergenic
1013060215 6:106626267-106626289 TCCCAGAAAATCTAAGCTGATGG + Intronic
1013800607 6:113937767-113937789 TCTTAGAACTTCTAGGCTTAGGG - Exonic
1017348157 6:153408473-153408495 TCTCAGAAGAGCCAGTCTTTGGG + Intergenic
1017393311 6:153966049-153966071 TCTCAGAATATTTGGTGTTATGG - Intergenic
1017794567 6:157832156-157832178 TATCTGAAAATCGAGTCATATGG + Intronic
1018138479 6:160802806-160802828 TCTCAGAAGAGCCAGTCTTTGGG - Intergenic
1018432328 6:163731842-163731864 TCTCAGACAACCCAGTCTTCAGG + Intergenic
1019895643 7:3980529-3980551 TTTCAGAAAATCTTATCTAATGG - Intronic
1020647175 7:10828976-10828998 TCTCAGAAGATCCAATCTTCAGG - Intergenic
1021007687 7:15420337-15420359 TTTCAGAAAATCTAATCCTATGG - Intronic
1021432737 7:20579460-20579482 TCTCACAACATCTAGCCCTAAGG - Intergenic
1023324505 7:39038531-39038553 TCTCTGAAAATTTAGCCTTAAGG + Intronic
1023914573 7:44579268-44579290 TCTTTCAAAATCTTGTCTTAGGG - Exonic
1024344479 7:48299134-48299156 TCTCAGAAAATCTCCTGCTAAGG - Intronic
1025313273 7:57980078-57980100 TCACAGAAAATCTAGACAGAAGG - Intergenic
1025711637 7:63916109-63916131 ATTCTGAAAATCTTGTCTTAGGG - Intergenic
1027852596 7:83467323-83467345 TCTCAAAATATGTAGTCTTTAGG + Intronic
1027915513 7:84314492-84314514 TCTGAGACATACTAGTCTTATGG - Intronic
1028485319 7:91350987-91351009 TCTCAGAAACTCTGTTCTCAGGG + Intergenic
1029410787 7:100408974-100408996 TCTCAGAGAAATTATTCTTATGG - Intronic
1029810851 7:103046943-103046965 TCTCAAAAGATCCAGTCTTTAGG + Intronic
1030562668 7:111110131-111110153 TCTCAAAAAATAAAGTCTTTAGG + Intronic
1030698226 7:112609418-112609440 TCTCAGAACAACTAGTTCTATGG + Intergenic
1030871475 7:114761173-114761195 TTTCAGAAAATGTAGTGCTAAGG + Intergenic
1031305337 7:120119139-120119161 TCTCAGAAGATCCAGTCTTCAGG - Intergenic
1031742569 7:125453213-125453235 TCTCAGAAGATCTAATCTTCAGG + Intergenic
1032987186 7:137350869-137350891 TCTAGGAAAATCTAATCATATGG - Intergenic
1033072478 7:138216698-138216720 TCTCAGAAGATCCAATCTTCCGG + Intergenic
1035863116 8:3051867-3051889 TTTCTGAAACTCTAGTCTTATGG - Intronic
1037204597 8:16300371-16300393 GTTTACAAAATCTAGTCTTATGG + Intronic
1038750243 8:30288050-30288072 TGCTAGAAAACCTAGTCTTAGGG - Intergenic
1038951234 8:32416596-32416618 ATTCAGAAAATCTAGGGTTAGGG + Intronic
1038999886 8:32968008-32968030 AGTCAGAAAATATAGGCTTAAGG - Intergenic
1040272932 8:45977084-45977106 TCACATAAAATCTAGACGTAAGG + Intergenic
1040402640 8:47067757-47067779 TCTCAGAAGATCCAATCTTCAGG - Intergenic
1040802998 8:51364224-51364246 TCTCAGAAAATTCAGTCTTCAGG - Intronic
1040903860 8:52444891-52444913 TCTCAAAAAAACTATACTTACGG + Intronic
1043251148 8:78074827-78074849 TATCAGAAAATGGAGTGTTATGG - Intergenic
1043827034 8:84941749-84941771 TCTCAGAAGATCCAATCTTCGGG - Intergenic
1044219368 8:89650658-89650680 TCTCAGAAAATGTACTCTCAGGG + Intergenic
1046017739 8:108626006-108626028 TCTCAGTAAACCAGGTCTTAAGG - Intronic
1046202638 8:110947394-110947416 TCTCAGAAGATCCAATCTTCAGG + Intergenic
1046579276 8:116071713-116071735 TCTCAGAAGATCCAGTCTTCAGG - Intergenic
1046882562 8:119325842-119325864 TCCCAGAAAATCTTATCTTAGGG + Intergenic
1046908117 8:119596236-119596258 TTTAAGAAAATCTAGTCATGTGG + Intronic
1048777651 8:137965242-137965264 TCTCAAGAAATTTTGTCTTAAGG + Intergenic
1049925683 9:404955-404977 TCTCAGGAACTCTAGCCTCATGG - Exonic
1050014404 9:1218754-1218776 TCTCACAAAATCTAGTGTCCTGG + Intergenic
1050263782 9:3869029-3869051 TCTCAGAGTATCCAGTCTAACGG - Intronic
1050401287 9:5258529-5258551 TTTCAGAAGATCCAGTCTTTGGG + Intergenic
1053333104 9:37234582-37234604 TATCAGAAAATCTATCCATAGGG - Intronic
1053696766 9:40646533-40646555 TCTCGGAAAATCCAGACTAAAGG - Intergenic
1054918348 9:70516918-70516940 ACTCAGAAATTCCAGTCATAAGG + Intergenic
1054956000 9:70910979-70911001 TATCAGAAATAGTAGTCTTATGG + Intronic
1056414534 9:86363427-86363449 TCTATGAAAATCTTATCTTATGG - Intergenic
1060027180 9:120183221-120183243 GCACTGAAATTCTAGTCTTAAGG - Intergenic
1060451121 9:123741475-123741497 TTTCAGACAATGTAGTCTTTTGG + Intronic
1203573875 Un_KI270744v1:158321-158343 TGTCAGAAAAGCTATTCCTAAGG - Intergenic
1185653503 X:1666357-1666379 TCTCAGAACAACGTGTCTTAGGG + Intergenic
1186155361 X:6719686-6719708 TCCCAGAAAATCTGGACTTTTGG - Intergenic
1186772174 X:12828949-12828971 TCTCAGAAAACCTTGTATTTAGG + Intergenic
1187093334 X:16120523-16120545 CCACAGAAAATCCAGTCTTTTGG + Intergenic
1189416027 X:40814196-40814218 TCTCAGAAGATCCACTCTTTGGG + Intergenic
1190876165 X:54461749-54461771 ACTCAGAGAATCCAGTCTTGGGG + Intronic
1191637946 X:63398065-63398087 TCTCAGAAGATCTGATCTTCAGG + Intergenic
1191865016 X:65697100-65697122 TCTCAAAAAATTTTTTCTTAAGG + Intronic
1193427895 X:81362102-81362124 TCTCAGAAAAACAAATCTTTAGG + Intergenic
1194051563 X:89075496-89075518 TCTCAGAAAATCCAATCTTTGGG + Intergenic
1194138244 X:90174785-90174807 TCTTAGAAGATCCAGTCTTCGGG + Intergenic
1194195472 X:90886251-90886273 TCTCAGAAGATCCAATCTTCGGG - Intergenic
1195522024 X:105842223-105842245 ACTAAGACAGTCTAGTCTTAGGG + Intronic
1195558771 X:106258676-106258698 TCTCAGAAGATCCAGTCTTTGGG + Intergenic
1195863143 X:109402299-109402321 CTTAAGAAAATCTAGTCTTAGGG - Intronic
1196464061 X:115955480-115955502 TCTCAGAAGATCCAATCTTTGGG - Intergenic
1198498462 X:137218224-137218246 TCTCAGAAGATCCAATCTTCGGG - Intergenic
1198642268 X:138769607-138769629 TCTCAGAAACTGTGGTCTTAAGG - Intronic
1198949695 X:142056591-142056613 TCTCAGAAGATCCAGCCTTTGGG + Intergenic
1199233574 X:145466986-145467008 TCTCAAAAGATCCAGTCTTCAGG + Intergenic
1199794623 X:151182292-151182314 TCTCCTAAAATCCAATCTTACGG + Intergenic
1200484041 Y:3745025-3745047 TCTTAGAAGATCCAGTCTTTGGG + Intergenic
1200690242 Y:6301399-6301421 TCACAGAAAATCTAACCTTGTGG + Intergenic
1201045031 Y:9873317-9873339 TCACAGAAAATCTAACCTTGTGG - Intergenic
1201354876 Y:13086402-13086424 TCTCAGAAGATTCAATCTTAGGG + Intergenic