ID: 1082853505

View in Genome Browser
Species Human (GRCh38)
Location 11:57786111-57786133
Sequence CTCAGAAAATCTAGTCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082853502_1082853505 24 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853505 11:57786111-57786133 CTCAGAAAATCTAGTCTTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082853505 Original CRISPR CTCAGAAAATCTAGTCTTAA GGG Intronic
901616718 1:10546167-10546189 CTTAGAAGATATATTCTTAATGG + Intronic
903826265 1:26147719-26147741 CTTAAAAAAACAAGTCTTAAAGG + Intergenic
908859464 1:68466686-68466708 TACAGAAAATCTAGCCTCAATGG - Intergenic
908859639 1:68469231-68469253 ATCATAAAATATACTCTTAAGGG - Intergenic
911240438 1:95459625-95459647 CTCAGTAAATATAGTTTGAATGG + Intergenic
911780646 1:101872350-101872372 TTCAGAAAATTTATTTTTAAAGG + Intronic
911866141 1:103025065-103025087 TTGAGAAAATGTAGTCTTAGTGG - Intronic
913129164 1:115823648-115823670 CTCAGATATTGTATTCTTAAAGG - Intergenic
915878496 1:159640231-159640253 CTAAGAAAATGGAGTTTTAAGGG - Intergenic
919583699 1:199409375-199409397 CTCAGAAAATTGAGTCTCAGAGG - Intergenic
921518431 1:216127365-216127387 TTCAGAAAATATATTCTAAAGGG - Intronic
923432998 1:233941767-233941789 GTTAAAAAATCTAGTCCTAAAGG - Intronic
923996293 1:239498578-239498600 CTCAGAAAGTCTATACTTAATGG - Intronic
1063345839 10:5311706-5311728 CTAAGAAAACTTACTCTTAACGG + Intergenic
1064516678 10:16156922-16156944 CTCACAAAATCTCGCCATAAAGG + Intergenic
1064719083 10:18210001-18210023 CTCTGAAAAATTAGTCTTAAGGG - Intronic
1064981615 10:21172658-21172680 CTCTGAAAATGGAGTCTTAAAGG + Intronic
1066411873 10:35178867-35178889 TTCAGAAAATCTTGTATTATAGG + Exonic
1068236409 10:54239829-54239851 GTCAGATAATCTAGGATTAAAGG + Intronic
1069266292 10:66462192-66462214 CTCAGAAAATGTACTTATAAAGG + Intronic
1070205670 10:74258270-74258292 CTTGGAAAATCTAGCCTAAAAGG + Intronic
1070383186 10:75900257-75900279 CTCTGAAAACCTTGTTTTAAGGG + Intronic
1070560209 10:77560692-77560714 CTCAGGAGATCTAGTGCTAAGGG - Intronic
1070595443 10:77829645-77829667 CTCAGAAAATCTCCTCTTGCAGG + Intronic
1075879527 10:125838803-125838825 GGCAGAATATGTAGTCTTAATGG - Intronic
1075990510 10:126834479-126834501 CTCAGAATATACATTCTTAATGG + Intergenic
1078342856 11:10512605-10512627 CTCAGCAAGTCTAATCTAAAAGG + Exonic
1078403682 11:11048933-11048955 CTCAGAGAATCTGGTACTAAGGG + Intergenic
1079718861 11:23785535-23785557 CCCAGAAAGTCAAGACTTAAAGG - Intergenic
1082647342 11:55744272-55744294 ATCAGAAACTCTAATCTCAACGG - Intergenic
1082853505 11:57786111-57786133 CTCAGAAAATCTAGTCTTAAGGG + Intronic
1087439626 11:98165646-98165668 CTCAGCAACTCTAATTTTAATGG + Intergenic
1087515857 11:99159914-99159936 GTCAGAAAATCTCATTTTAAAGG + Intronic
1088342121 11:108780024-108780046 ATAAGAAAATCTATCCTTAATGG + Intronic
1090252367 11:125260705-125260727 GGCAGAAGATGTAGTCTTAATGG - Intronic
1090348152 11:126087605-126087627 CTCAGAAACTCTACTCTAACTGG - Intergenic
1092659007 12:10718860-10718882 TTCATAAAATCTAGTCATTAAGG - Intronic
1094126336 12:27026587-27026609 CTCAAGAAATCTAATTTTAAAGG - Intronic
1095713360 12:45314627-45314649 CTCCCAAAATGTAGTCTTCAAGG - Intronic
1097342044 12:58449925-58449947 TTCTGAAAATCTAGTCAAAAAGG - Intergenic
1098814954 12:75147644-75147666 CTCAGAAAATTTCGTCTTGCAGG - Intronic
1100621959 12:96285215-96285237 CTAAGAAAATCTAGTTAGAATGG + Intronic
1102852643 12:116264175-116264197 CCCAGAAAATCTTATTTTAAGGG - Intronic
1108976324 13:56447544-56447566 ACCAGAAAATCTAGTCGAAATGG + Intergenic
1109031777 13:57199666-57199688 CTCAGAAAGTGTAGTCCTCATGG + Intergenic
1109098066 13:58143302-58143324 CTCAGAGAATTTTCTCTTAATGG - Intergenic
1109531086 13:63648998-63649020 CTCAGATAATCTTGTCGAAATGG - Intergenic
1110066988 13:71120942-71120964 ATCATAAAATATAGTCTTCATGG - Intergenic
1110369087 13:74719819-74719841 CTCAGAAAATAGAGTATAAATGG + Intergenic
1111022766 13:82476605-82476627 TTCAGAGAATCTAGTCATTAAGG - Intergenic
1114397624 14:22381105-22381127 CTAAGAAAATGCAGTCTTTAGGG - Intergenic
1115153585 14:30313672-30313694 CTCAGAAAATCTAGTGTTCAGGG - Intergenic
1115597032 14:34919365-34919387 CCCTGAAAGTATAGTCTTAATGG + Intergenic
1116979103 14:51149241-51149263 ACCAGAAAATCAAATCTTAAAGG + Intergenic
1119056474 14:71426995-71427017 CTCTAAAAATTTAGTCTAAAAGG - Intronic
1119653430 14:76399670-76399692 CTCAGATAATCTGGGCTGAAAGG + Intronic
1202945435 14_KI270726v1_random:21657-21679 CTCAGAAAGTAAAGTCCTAAAGG - Intergenic
1127051533 15:55089110-55089132 CTAAGAAAAAAAAGTCTTAAAGG - Intergenic
1128530665 15:68444158-68444180 ATCAGAAACTCTAGTCCTAAAGG - Intergenic
1129139244 15:73582186-73582208 CAAAGAAAATCTATCCTTAAAGG + Intronic
1129542259 15:76360022-76360044 ATCACAAAATCTATTCTTCAAGG - Intronic
1130025757 15:80269183-80269205 CTGAGCAAATCTAGTATCAAGGG + Intergenic
1130748219 15:86679714-86679736 CTAAGAAAATATAGTAATAATGG - Intronic
1131048493 15:89331522-89331544 CACAGTAAAACTAGTATTAATGG - Intronic
1135882772 16:26275263-26275285 CTCAGAAAGACTATTGTTAAAGG + Intergenic
1137313440 16:47289603-47289625 ATTAGAAAATCTAGTGTAAATGG - Intronic
1144051478 17:11500700-11500722 CTCAGAAAATGAATTTTTAATGG - Intronic
1144519899 17:15946371-15946393 CTGAGAAAATCTAGGATTCAGGG + Intronic
1144963667 17:19061907-19061929 CCCTGAAAGTATAGTCTTAATGG - Intergenic
1144964011 17:19064119-19064141 CCCTGAAAGTATAGTCTTAATGG + Intergenic
1144983943 17:19188011-19188033 CCCTGAAAGTATAGTCTTAACGG - Intergenic
1144984282 17:19190228-19190250 CCCTGAAAGTATAGTCTTAACGG + Intergenic
1147548387 17:41420782-41420804 CTCAGTGAGTCTAGTCTTGAAGG + Exonic
1157981264 18:52383950-52383972 ATCAGAAAAGCAATTCTTAAAGG - Intronic
1160489753 18:79326751-79326773 CTTAGAAAATCTGATTTTAAAGG + Intronic
1161729202 19:5948627-5948649 CTCAGAAATTCTTGTCAAAAGGG + Intronic
1164911846 19:32019085-32019107 CTCTGAAAATCAGGTCTTTAGGG - Intergenic
925226389 2:2187054-2187076 CTCACACAATCCAGTCTTTATGG + Intronic
926554807 2:14344328-14344350 CTCAGAAAAGCTAGTATAAAAGG + Intergenic
928556510 2:32432022-32432044 CTCACAAAATATAGTCCTCAGGG - Intronic
929195512 2:39180526-39180548 CTCAGTAAAACTAGACTTACTGG + Intronic
932119010 2:69081000-69081022 CTCAGGAAATCTAGACATCATGG + Intronic
937656739 2:124385506-124385528 CCCAGAGAATATAGTCTTATGGG - Intronic
937819932 2:126298564-126298586 CTGTGAAAATGTAGTCTAAAGGG + Intergenic
938510057 2:131932110-131932132 CTCAGAAAACCTAGGATAAAAGG + Intergenic
938628402 2:133137624-133137646 CTAAGAAAATTTAGTCATATGGG - Intronic
940071881 2:149698011-149698033 AACAGAAAATCTAGTCAGAAAGG + Intergenic
942404430 2:175638620-175638642 CTCATAAAATCATGTCCTAATGG - Intergenic
944531504 2:200672490-200672512 ATGAGAAAATCTGCTCTTAAAGG - Intronic
945434747 2:209806268-209806290 CTGACAAAATCAAGTGTTAATGG + Intronic
946672335 2:222118961-222118983 CTCAGAAACTCTAATATTCAAGG - Intergenic
946949334 2:224855726-224855748 CTCAGGAAATCTACTTTGAAAGG + Intronic
1171157772 20:22892046-22892068 CTCAGAAAATCTAATATTCATGG - Intergenic
1172372275 20:34403776-34403798 CTCAGGAAATATAATTTTAATGG + Intronic
1173103288 20:40107534-40107556 CTCCAAAAAGCTAGTCTTAGTGG - Intergenic
1173958767 20:47055283-47055305 TTCAGAAACTCTGGTCTTTATGG + Intronic
1174268542 20:49349950-49349972 CTCAATAAATCTTGTTTTAAAGG - Intergenic
1177027068 21:15933181-15933203 CTCAGTAAATTTAGTCTAAATGG - Intergenic
1177155724 21:17499538-17499560 CTCAGAAAAACTGGGATTAAGGG - Intergenic
1177595908 21:23242135-23242157 CACACATAATCTTGTCTTAAAGG - Intergenic
1177981415 21:27919952-27919974 CTCAGAAAACCTAGGGTAAAAGG - Intergenic
949560962 3:5202159-5202181 CACAGAACATCTACTCTTTAAGG - Intronic
949792228 3:7805358-7805380 CTCAGAGATTCTAGTCTAACTGG + Intergenic
951600985 3:24375621-24375643 CTAAGAAAATTTAGCTTTAAAGG - Intronic
954940736 3:54370000-54370022 TTAAGAACATCTAATCTTAAGGG - Intronic
955317451 3:57950614-57950636 CTCAGGAAATGTGGTCTAAAAGG - Intergenic
958244686 3:91135020-91135042 CACAGAAAAACTAGACATAATGG + Intergenic
959271404 3:104215175-104215197 CTCAGAAAAGGAAGTCTTTAAGG - Intergenic
960162933 3:114370181-114370203 CTGAGAAAAACCAGTGTTAAGGG - Intronic
962395205 3:135009363-135009385 CTCAGAAAGTCATGTATTAAAGG + Intronic
962516068 3:136153372-136153394 CTCATAAAAGATAGTCTTGAGGG + Intronic
963017795 3:140842201-140842223 ATCAGAAAATCTAGAATTACTGG - Intergenic
963656008 3:148050863-148050885 CTCAGAAAAAAAAGTATTAAGGG - Intergenic
965943256 3:174210510-174210532 CTCAGAAAATCTAGTCATCGTGG - Intronic
966011872 3:175088252-175088274 TTCTGAAAATCTATTCTTTAAGG - Intronic
966536261 3:181037646-181037668 CTCAGAAGATCCAGTCTTCAGGG + Intergenic
967425331 3:189320418-189320440 CTGAGGAAAGTTAGTCTTAATGG + Intronic
968202183 3:196764279-196764301 ATCAGAAAATCTCTTCCTAAAGG - Intronic
969598035 4:8159789-8159811 CACAGAAAATGTAGACTGAATGG + Intergenic
970636492 4:18015679-18015701 CTAAGTAAATCTACTCTTATGGG + Intronic
970695732 4:18674880-18674902 CTCAGAAAACTAAGTCTTAATGG + Intergenic
970986965 4:22170385-22170407 CTTAAAAAATCTAGTCTATATGG + Intergenic
971497317 4:27280625-27280647 CACAGAAAAGCCAGACTTAAGGG - Intergenic
971977942 4:33714930-33714952 CTCAGAAAAGCTAGAATTAATGG + Intergenic
972344087 4:38178127-38178149 CACAGGAAATCCAGTCTTATTGG - Intergenic
973642286 4:52915370-52915392 CTCAGAAAAACCAGGCTTACTGG + Intronic
975978325 4:80125422-80125444 CTCAGAAAGTCTTTTCTTGAAGG + Intronic
976429711 4:84948168-84948190 CTCAGAAAATAAATTCCTAAAGG + Intronic
979894058 4:126135515-126135537 CTCAGAAAATACAGTTATAATGG - Intergenic
979970775 4:127132059-127132081 CTCAGAAAATCTATTCAAATTGG + Intergenic
980846026 4:138326180-138326202 GTCAGAAATTTTATTCTTAAGGG + Intergenic
981751559 4:148097275-148097297 CCCAGGAAATGTAGGCTTAAAGG - Intronic
981956162 4:150476989-150477011 GTCAGAACATTTGGTCTTAATGG + Intronic
983234217 4:165160627-165160649 CTCAGATCATCTAGTCAGAATGG - Intronic
984013976 4:174404600-174404622 CTTAGACAATGTGGTCTTAATGG - Intergenic
987130512 5:14855792-14855814 CTGAGAAAATCCAGCCTTAAAGG + Intronic
987278198 5:16384747-16384769 CTCAGAAAATTGAATCTTAGAGG + Intergenic
988000812 5:25345741-25345763 CTTACAAACTCTAGTTTTAAAGG + Intergenic
988320413 5:29687525-29687547 CTTTGAAAATATAGTCCTAAGGG - Intergenic
989133284 5:38128372-38128394 GTCAGAGAATTTAGTCTGAATGG + Intergenic
989228189 5:39054644-39054666 CTCAAAAAATGTAGACTGAATGG - Intronic
989999496 5:50876449-50876471 CTCAGGAAATCTTGTATAAAAGG - Intergenic
990323612 5:54652940-54652962 CTCAGAAAAGCCAGTAATAAAGG + Intergenic
990970287 5:61498643-61498665 TTCAAAAAATATAGTCTCAAAGG - Intronic
991309119 5:65215323-65215345 CTCAGAAAATCTCATCGTCATGG - Exonic
992414853 5:76542481-76542503 CTCAGAAAATCCACTCTAACAGG - Intronic
993235972 5:85310635-85310657 CTCAGAAAAACAAGTCCAAATGG + Intergenic
994289685 5:98014337-98014359 CTCACAAAATCTAGTCCCTAAGG + Intergenic
995381992 5:111545625-111545647 GTCAGAAAAGCCAGTCTCAAAGG - Intergenic
997926995 5:138039748-138039770 CACAGAAAATGTGGTCTGAATGG - Intronic
998517112 5:142766616-142766638 CCCAGAAAATCTGCTCATAAGGG - Intergenic
1003584227 6:7372159-7372181 CTTAGAAAATCTTTTCTCAAAGG + Intronic
1003729422 6:8804495-8804517 CTAAGAACCTATAGTCTTAATGG - Intergenic
1004536342 6:16506077-16506099 CTCAGAAAATCTTGGCATCAGGG + Intronic
1005413063 6:25571234-25571256 CTCAGAAAATCCAGTTGAAAGGG + Intronic
1010267851 6:73886984-73887006 CTGAGTAAATCTAGTTTTTAAGG - Intergenic
1010471211 6:76230521-76230543 GACAGAAAATATAGGCTTAAAGG - Intergenic
1010485209 6:76403110-76403132 TTCTGAATATCTAGTCTGAAGGG + Intergenic
1011780241 6:90780658-90780680 CTGAGAAAATTTCTTCTTAATGG - Intergenic
1012135739 6:95553418-95553440 CTCAGAGAATCTAATCTGCAGGG - Intergenic
1012371454 6:98512250-98512272 TTAATAAAATATAGTCTTAAAGG + Intergenic
1013089163 6:106883738-106883760 CTCAGAAAATGATATCTTAAAGG - Intergenic
1013645997 6:112141982-112142004 CTCAGAAGATCTCATTTTAATGG - Intronic
1014477016 6:121886149-121886171 CTAAGAAAATATAGGCTAAAAGG - Intergenic
1014929282 6:127314403-127314425 CTCAGAAAATCTCTTTTTATTGG + Intronic
1015552034 6:134421559-134421581 ATCAGAAAATCTGTTCTTCATGG + Intergenic
1018377115 6:163223466-163223488 CTCAGAAAATGTTTTCTCAATGG - Intronic
1020378123 7:7510863-7510885 GTCAGAAAATGAAGTCTTAATGG + Intronic
1021296901 7:18919350-18919372 CTCACAAAATATAGTCCTAAAGG - Intronic
1021308172 7:19057510-19057532 CTTAGAAAATATAGTTTTAGTGG - Intronic
1021664630 7:22963592-22963614 GTCAGAAAATTTTTTCTTAATGG + Intronic
1023061697 7:36333825-36333847 GTCAGAAAACCTAGAGTTAAGGG + Intronic
1023638158 7:42234172-42234194 CTAAGAAAAACCAGTCTTGAAGG - Intronic
1024206731 7:47169184-47169206 CTTACCAAATCTAGTCTTCAGGG + Intergenic
1026824244 7:73571361-73571383 CTCCGAAAATGAAGTTTTAAAGG - Intronic
1027338637 7:77181850-77181872 CTCAGAAAAACAAGTCTTTAAGG - Intronic
1027852597 7:83467324-83467346 CTCAAAATATGTAGTCTTTAGGG + Intronic
1028682446 7:93552174-93552196 ATGAGAAAATTTAGTCTGAAGGG - Intronic
1031323998 7:120368930-120368952 CACAGAAAACCTAATCTTGAAGG - Intronic
1032381920 7:131493592-131493614 AACAGAAAATCCAGTGTTAATGG + Exonic
1032601533 7:133301238-133301260 CTAAGTAAATCTAGGCTTCAGGG + Intronic
1033317347 7:140308655-140308677 CTCAGAAGATAAAGTCTAAACGG + Intronic
1033593881 7:142840271-142840293 CACAAAAAATGTAGTCCTAAGGG + Intergenic
1033605176 7:142921768-142921790 CTCAAATTATATAGTCTTAAAGG - Intronic
1035178922 7:157075262-157075284 TTCAGTAAATCTTGTCTGAAGGG - Intergenic
1036015950 8:4784849-4784871 CTCAGCAAATTTAGTTTTAATGG - Intronic
1037008380 8:13809560-13809582 CTCAGGAAATCTGTTCTCAATGG + Intergenic
1037429767 8:18797854-18797876 CTCAAAATATCTAGTGTGAAGGG + Intronic
1038921044 8:32084718-32084740 ATCATAAAATCCAGTCTTCACGG + Intronic
1040038587 8:42895368-42895390 ATGAGAAAACCTACTCTTAATGG + Intronic
1043541806 8:81271947-81271969 CTCAGAAAATCTTTTGTCAAAGG + Intergenic
1043839242 8:85082823-85082845 CATAGAAACTCTAGTCATAAGGG - Intergenic
1043922565 8:86000340-86000362 CACAGAAATTCTATTATTAATGG + Intronic
1044309078 8:90671890-90671912 CTCATAAAACCTAGTCTGAGAGG - Intronic
1046417254 8:113934290-113934312 ATCACAAAATTTAGACTTAATGG - Intergenic
1047477932 8:125252930-125252952 GTAAGAAAATTTAGGCTTAAGGG - Intronic
1047789265 8:128186045-128186067 CTTAGAGATTCTTGTCTTAAAGG + Intergenic
1048941012 8:139400894-139400916 CTCCAAAAATCTAGTTTTTATGG + Intergenic
1051111717 9:13646259-13646281 TTCAAAAAATCTTGTGTTAAAGG - Intergenic
1051322185 9:15917601-15917623 CTCAAAAAATTTATTTTTAAAGG + Intronic
1052677076 9:31640773-31640795 CTCAGTAAATCTAGTGTAATAGG - Intergenic
1055566772 9:77577449-77577471 CTCATAAACTCAAGTCTTAGTGG + Intronic
1057306866 9:93917399-93917421 ATGAGAAAATCGAGTCTCAAAGG + Intergenic
1057941328 9:99287826-99287848 CTAGGCAATTCTAGTCTTAAGGG + Intergenic
1058494356 9:105539308-105539330 CTGAGTAAATTTTGTCTTAAAGG - Exonic
1186658028 X:11637112-11637134 CGCAGAAAATCTTGACTGAAAGG + Intronic
1187185501 X:16980908-16980930 CACAGAAAATCTAAACTTAAAGG + Intronic
1188287076 X:28340708-28340730 CTCAGAAAAACTCATTTTAATGG + Intergenic
1192034845 X:67550955-67550977 CTCATGTCATCTAGTCTTAAGGG - Intronic
1198099262 X:133410063-133410085 CATAGACAATCTAGTGTTAATGG - Intronic
1198479126 X:137024486-137024508 CTCACAAAATTTGGTATTAAAGG + Intergenic
1202087002 Y:21148670-21148692 CTCATCAAATCTAATCTAAAAGG + Intergenic