ID: 1082853507

View in Genome Browser
Species Human (GRCh38)
Location 11:57786113-57786135
Sequence CAGAAAATCTAGTCTTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 16, 3: 22, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082853502_1082853507 26 Left 1082853502 11:57786064-57786086 CCAGTAATGTAGGACTTAATGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1082853507 11:57786113-57786135 CAGAAAATCTAGTCTTAAGGGGG 0: 1
1: 0
2: 16
3: 22
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082853507 Original CRISPR CAGAAAATCTAGTCTTAAGG GGG Intronic
901037890 1:6347216-6347238 CAGAAATTCTAGGCTTAGGAGGG - Intronic
902545295 1:17186090-17186112 CAGATCATCTAGTCTGATGGGGG - Intergenic
906384396 1:45354884-45354906 AAGAAAATATAGGCTTATGGTGG + Intronic
907669302 1:56460867-56460889 CAGAAAATCTAGATTTAGAGAGG + Intergenic
908757586 1:67483027-67483049 TGGAGAATCTAGTCTCAAGGTGG - Intergenic
909273702 1:73657404-73657426 AAGAAAATCTAATCTTAATAGGG - Intergenic
910275054 1:85440765-85440787 CAGAGAAGGTAGTGTTAAGGGGG - Intronic
910753292 1:90657743-90657765 CTGAAAATATAGTCTTGACGAGG - Intergenic
910935886 1:92484446-92484468 CAAAAAATCTTGTCCTAGGGAGG + Intronic
917606118 1:176631669-176631691 CAGAAATTTTAGTGATAAGGAGG + Intronic
917688286 1:177440729-177440751 CACAAAATCTAGACTTAACCAGG - Intergenic
919654337 1:200182755-200182777 CGGAAAATATAGTCTTCAGCTGG - Intergenic
920144281 1:203844757-203844779 CAGAAAATAAAGTCTTACTGTGG - Intronic
920434763 1:205940676-205940698 CAGAAAATCTTGTCAGAAGAGGG + Intronic
1074014159 10:109516413-109516435 CAGAAAAGCGAGTCTGAAGATGG + Intergenic
1076770758 10:132662986-132663008 AGGAAAATCTAGTCTTGTGGTGG + Intronic
1078223665 11:9372872-9372894 CAGAAACTCTAGCTTTTAGGTGG - Intergenic
1080218698 11:29875521-29875543 CCAACAATTTAGTCTTAAGGAGG + Intergenic
1082853507 11:57786113-57786135 CAGAAAATCTAGTCTTAAGGGGG + Intronic
1086739462 11:90350246-90350268 GAGGAAATTTAGTTTTAAGGAGG + Intergenic
1087957361 11:104304886-104304908 AAGAAAATCTAGTCCTATGATGG + Intergenic
1089115132 11:116088704-116088726 CAGAAAATATAGGCTTCATGAGG + Intergenic
1090573897 11:128079214-128079236 CAGAAAATGCAGTATTAAGAGGG + Intergenic
1095566396 12:43628792-43628814 CAGAAGACCCAGTCATAAGGAGG - Intergenic
1096672103 12:53206139-53206161 CAGAACATGTATTCTCAAGGAGG - Intronic
1099349938 12:81553787-81553809 CAGAAAAAATAGTGATAAGGTGG + Intronic
1099382924 12:81977108-81977130 TAGAAACTTCAGTCTTAAGGGGG - Intergenic
1100410489 12:94312913-94312935 CAGAAAATCAGGTCTTAAATAGG - Exonic
1104334831 12:127884448-127884470 CACAAATTCTATTCTTATGGGGG + Intergenic
1106683093 13:32028326-32028348 GAGAAAATTGAGGCTTAAGGAGG - Intergenic
1107169553 13:37324039-37324061 CTGAAAATTTATTCTTAAGATGG + Intergenic
1107610807 13:42111160-42111182 CACAAAATACAGTCTCAAGGAGG + Intronic
1108093136 13:46871917-46871939 CAGAAAATCATGTCTTATGCAGG - Intronic
1108693331 13:52879947-52879969 CAGAAAAACAAATGTTAAGGTGG - Intergenic
1109872010 13:68344403-68344425 CATAGAATCTACTCTTAATGTGG - Intergenic
1109923809 13:69106817-69106839 CAGTAACTTTAGTCTTCAGGTGG - Intergenic
1110116597 13:71824975-71824997 CAAATAATGAAGTCTTAAGGAGG + Intronic
1112731843 13:102371496-102371518 CAGAAAAAGTAGTCTGATGGAGG - Intronic
1113145688 13:107204563-107204585 CAGAAAAAGTAATCTTAAGTAGG + Intronic
1114375266 14:22139359-22139381 CAGAAAATCTAGTCTTTGGAAGG - Intergenic
1114397622 14:22381103-22381125 AAGAAAATGCAGTCTTTAGGGGG - Intergenic
1114715804 14:24822677-24822699 AAGAAGATGTAGTCTTAAGGGGG - Intronic
1116979106 14:51149243-51149265 CAGAAAATCAAATCTTAAAGGGG + Intergenic
1118250521 14:64155971-64155993 CAGAAAATCGAGGCTTAGAGAGG - Intronic
1120502483 14:85313667-85313689 TAGAAAAGCTAGTATTAAGGTGG + Intergenic
1202846056 14_GL000009v2_random:177111-177133 CAGAATATCTAGTGTTAATGAGG - Intergenic
1202915518 14_GL000194v1_random:167715-167737 CAGAAAATCTAGTGTTAATGAGG - Intergenic
1202877222 14_KI270722v1_random:15337-15359 CAGAAAATCTAGTGTTAATGAGG + Intergenic
1124548819 15:30658248-30658270 CATAAACACTAGTCTTAATGAGG - Intronic
1127792391 15:62409881-62409903 CTAAAAATCTTGTCTTTAGGGGG - Intronic
1131853589 15:96568506-96568528 CAGAAAATATAGTTTCAAGATGG + Intergenic
1133688459 16:8189644-8189666 CAGAAACTCTGGTCATAAAGAGG - Intergenic
1134317087 16:13128471-13128493 CAGAAAATTTAGGCTTAGAGAGG - Intronic
1136576782 16:31130002-31130024 CAGTAAATCTAGGGTTGAGGAGG - Exonic
1136990981 16:35151250-35151272 AAGAAACTCTAGTCTTGAGGTGG + Intergenic
1137811146 16:51353909-51353931 CAGAAAATCTAGTAATAATGTGG + Intergenic
1137975425 16:53027243-53027265 CAGAAAAAAGAGTCTTGAGGAGG + Intergenic
1140030537 16:71334819-71334841 AACAAATTCTAGTTTTAAGGTGG - Intergenic
1140093902 16:71859120-71859142 AAGAAAATCCAGAATTAAGGTGG - Intronic
1142700486 17:1657060-1657082 CAAAAAAACGTGTCTTAAGGAGG + Intronic
1143353914 17:6310389-6310411 CAGACCATCTAGTGATAAGGAGG + Intergenic
1144106539 17:11991454-11991476 CAAACATTCTAGTCTAAAGGTGG + Intronic
1149380519 17:56088737-56088759 CAGAAAATCCCATCTTAAGGTGG - Intergenic
1151283402 17:73092763-73092785 CAGAGAATCTATTCTTCAGGCGG - Intergenic
1155229848 18:23762275-23762297 CACAAAATACAGTTTTAAGGAGG + Intronic
1155667370 18:28327595-28327617 CAGAAAACGCAGACTTAAGGTGG + Intergenic
1158776402 18:60586797-60586819 AAGGAAATCTAGTCATAAGCAGG - Intergenic
1159523323 18:69554960-69554982 CAGACAATCCAGTTTTAAAGAGG - Intronic
1160410111 18:78669854-78669876 CAGAGAATCACATCTTAAGGTGG - Intergenic
1163233895 19:16020256-16020278 CAGAAAATCCAGGCCTGAGGCGG - Intergenic
1167556544 19:50199674-50199696 CAGAAAATCAAGTCCAAAGGAGG - Intronic
1167786542 19:51642707-51642729 CAGAAATTCAAGTGTTAAGAAGG + Exonic
1202673458 1_KI270710v1_random:17596-17618 CAGAAAATCTAGTGTTAATGAGG - Intergenic
925321531 2:2973864-2973886 CAGACAATCTAGTCGTAATACGG - Intergenic
927420385 2:22924930-22924952 GAGGAAATCAAGTCTCAAGGTGG + Intergenic
929624630 2:43393930-43393952 CAGAAAATCTTATATTGAGGAGG - Intronic
933334522 2:80939949-80939971 CAGAGACTCTAGCCTTAAAGAGG - Intergenic
933572185 2:84026654-84026676 CAGACTATCTAGTCTTAGGATGG - Intergenic
934953017 2:98592209-98592231 CAGAAAATCGGCTCTTAAGAGGG - Intronic
937013191 2:118580225-118580247 CTGAAATTCTAGTCTGAAGTTGG - Intergenic
937656736 2:124385504-124385526 CAGAGAATATAGTCTTATGGGGG - Intronic
943292701 2:186094967-186094989 AAAAAAATCTAGTCTTAATTTGG - Intergenic
946944524 2:224807028-224807050 AAGGAAATGGAGTCTTAAGGAGG + Intronic
948774243 2:240273937-240273959 TAGAAAAACTAGTCTCATGGGGG + Intergenic
1171172747 20:23030310-23030332 GAGAAAATCAAGGCTTAAAGAGG + Intergenic
1172328996 20:34061191-34061213 AAGACAATCTAGGCTTAATGGGG - Intronic
1176050238 20:63115482-63115504 GAGAAAACCGAGTCTTAAGGAGG - Intergenic
1176634870 21:9182363-9182385 CAGAAAATCTAGTGTTAATGAGG - Intergenic
1176638498 21:9272781-9272803 CAGAAAATCTAGTGTTAATGAGG + Intergenic
1177004525 21:15655143-15655165 CAGAAAACCTAGTGATAAAGTGG - Intergenic
1177065467 21:16428316-16428338 CAGAAAATGAAGGCTTAAAGAGG + Intergenic
1178150842 21:29791634-29791656 AGGAAAATTTATTCTTAAGGTGG + Intronic
1178257736 21:31070424-31070446 CAGAAAATCTGGACTTTAGGAGG - Intergenic
1180370473 22:12030634-12030656 CAGAAAATCTAGTGTTAATGAGG - Intergenic
1180371801 22:12045616-12045638 CAGAAAATCTAGTGTTAATGAGG + Intergenic
1180415271 22:12704435-12704457 CAGAAAATCTAATGTTAATGAGG + Intergenic
1180422540 22:12880278-12880300 CAGAAAATCTAGTGTTAATGAGG + Intergenic
949560960 3:5202157-5202179 CAGAACATCTACTCTTTAAGGGG - Intronic
952529815 3:34251950-34251972 GAGAAAAGCTAGTCTTCAAGGGG - Intergenic
955369200 3:58336485-58336507 CAGAAAGGCTAGTATTTAGGGGG + Intronic
956229716 3:66999436-66999458 CAGAAAATCTAGACTTGTGCTGG + Intronic
957102360 3:75844320-75844342 CAGAAAATCTAGTGTTAATGAGG - Intergenic
958783659 3:98573596-98573618 CAGAAAATCTAATCTGCAGGGGG - Intronic
959483171 3:106897976-106897998 CAGAAGCTTTAGTCTTAAAGCGG + Intergenic
961914865 3:130363745-130363767 CAGAAAAGCAAGTGTTAAAGTGG - Intronic
963187078 3:142430353-142430375 TAGAAGATCTAGTGTTAAGGAGG - Intronic
967571227 3:191030497-191030519 CAGAAAATTCAGTATTAGGGTGG - Intergenic
1202748397 3_GL000221v1_random:132240-132262 CAGAAAATCTAGTGTTAATGAGG - Intergenic
971430589 4:26562504-26562526 CAGAAAAAGTAGTGCTAAGGAGG - Intergenic
971758294 4:30731028-30731050 CAGAAATTCCATTCTTAAAGAGG + Exonic
974277107 4:59736111-59736133 CTGAAAATCTAAAATTAAGGTGG - Intergenic
976570735 4:86606695-86606717 AAAAAAATCTAGTCTTGAGTGGG - Intronic
976886465 4:89990739-89990761 AAGAAAATCTAGACTGAATGTGG + Intergenic
977669451 4:99679197-99679219 CAGAAACTCAAGACTTAATGAGG - Intergenic
978958811 4:114649694-114649716 TAGAAAATGTAGTCTTTAGCTGG + Intronic
979788528 4:124748666-124748688 CAGAATACCCAGTATTAAGGGGG + Intergenic
981013683 4:139951804-139951826 TAGCAAGTCTAGTATTAAGGGGG + Intronic
982248981 4:153385359-153385381 CAGAAAATCCAGGTTTAAGAGGG + Intronic
982485661 4:155962537-155962559 CACCAAATCTAGACTTAATGTGG - Intergenic
982734875 4:158995554-158995576 CAGAAAATATTTTCTAAAGGAGG - Intronic
982878443 4:160677251-160677273 CAGAAAATCTAGTTTTGGGCAGG - Intergenic
982880721 4:160711320-160711342 CTGAAAATCTTTTCTTATGGTGG + Intergenic
983269545 4:165545232-165545254 CAGAAGATATTCTCTTAAGGTGG + Intergenic
1202753385 4_GL000008v2_random:31195-31217 CAGAAAATCTAGTGTTAATGAGG + Intergenic
988315001 5:29613745-29613767 TAGAAAATATAGTCTTTGGGGGG + Intergenic
990267966 5:54098824-54098846 TAGGAAATCCAGTTTTAAGGAGG + Intronic
993429018 5:87807856-87807878 CAGACATTCTAATCTTAAGGTGG - Intergenic
995276909 5:110287690-110287712 TAGAAAATCTAGTCTATGGGAGG - Intergenic
998755064 5:145368861-145368883 CAGAGAAGCTAGTGTTACGGAGG + Intergenic
999920312 5:156311214-156311236 CAGGGAATCTAGTCTCAAGCAGG - Intronic
1000798940 5:165700349-165700371 CAGAAAATCTTTTCTCAATGAGG - Intergenic
1001794093 5:174487488-174487510 CCGATAATCTACTCTCAAGGAGG + Intergenic
1005473053 6:26180993-26181015 CAGAAATTTTAGTCTTTAGCAGG + Intergenic
1005732391 6:28710571-28710593 CAAAAAAGCTAGCTTTAAGGGGG + Intergenic
1007341909 6:41195991-41196013 CATAAAACCTGGTCTTCAGGGGG + Intronic
1011625530 6:89280386-89280408 CAGACAGTCTGGTCTGAAGGGGG + Intronic
1011945585 6:92898172-92898194 CAGAATATCTCTTCTTATGGAGG + Intergenic
1015219005 6:130782685-130782707 CTGAAAATCTAGTTTTTAGCTGG + Intergenic
1020897181 7:13955022-13955044 CAGAAAATTTCGTTTTAAGAAGG - Intronic
1022242991 7:28530868-28530890 CAGAAGATCTTGTCTTAATAAGG - Intronic
1022328998 7:29360218-29360240 CAGAATGTCGAGTCTTAATGGGG - Intronic
1022827715 7:34033447-34033469 CAGAAAATCACTTCTTAAGGTGG - Intronic
1028666811 7:93354199-93354221 CAGAAAACCGAGACTTAAAGAGG + Intronic
1031780013 7:125949566-125949588 CAGAAAAACAAGTCTTAGAGAGG - Intergenic
1032269840 7:130394463-130394485 GAGAAAACCTACTCTTAAGATGG + Exonic
1032325128 7:130920848-130920870 CAGAAAATTTAGTCTGAAGTTGG + Intergenic
1035178920 7:157075260-157075282 CAGTAAATCTTGTCTGAAGGGGG - Intergenic
1038005634 8:23427581-23427603 AAGAAAATCAAGGCTTAAGAAGG - Intronic
1038191829 8:25328910-25328932 CAGAAAATTGAGTTTTAAAGTGG + Intronic
1039639693 8:39205763-39205785 CAGGAAATATAATTTTAAGGAGG - Intronic
1041569096 8:59315796-59315818 CATAAAATCTTGTCTTAATTTGG - Intergenic
1042694747 8:71544469-71544491 CGGAAAGTTTAGTCTTTAGGAGG + Intronic
1044777808 8:95711830-95711852 GAGAAAATATAGTCTGCAGGAGG - Intergenic
1045211241 8:100102323-100102345 TAGAAAATGTAGTCTTAATTTGG + Intronic
1047645866 8:126869072-126869094 AAGAAAATATAGACTTAAAGAGG + Intergenic
1051026235 9:12615094-12615116 CAGAAAACCAAGTCTTACAGAGG - Intergenic
1051610957 9:18960854-18960876 CAGAAAAACTAATCTTTAGTGGG + Intronic
1056947213 9:91008519-91008541 AAGAAAATATAGTCTTGAGATGG + Intergenic
1058569946 9:106330618-106330640 CAGAAACTTTATTATTAAGGGGG + Intergenic
1059040337 9:110807854-110807876 CAGAAAGCCTAGTCCTGAGGAGG - Intergenic
1203757649 Un_GL000218v1:149663-149685 CAGAAAATCTAGTGTTAATGAGG - Intergenic
1203717036 Un_KI270742v1:162330-162352 CAGAAAATCTAGTGTTAATGAGG - Intergenic
1203534176 Un_KI270743v1:15904-15926 CAGAAAATTTAGTGTTAATGAGG + Intergenic
1203651264 Un_KI270751v1:125919-125941 CAGAAAATCTAGTGTTAATGAGG - Intergenic
1186596962 X:10992431-10992453 GAGAAAATCGAATCTTAGGGAGG - Intergenic
1187066161 X:15840112-15840134 CAGTAAATCTATTCATAAAGTGG + Intronic
1187305340 X:18090350-18090372 CAGAAACTCTAGGGTTGAGGTGG - Intergenic
1189157664 X:38775158-38775180 AAGAAAATCAAGGCTTAGGGAGG - Intergenic
1190443982 X:50504629-50504651 CAGAAAATGAAGCCCTAAGGAGG - Intergenic
1191663502 X:63674300-63674322 TAGAAAATGTAGTCTTTAGGTGG - Intronic
1195863142 X:109402296-109402318 AAGAAAATCTAGTCTTAGGGTGG - Intronic
1197920423 X:131587311-131587333 CAGAAAACATAATCTCAAGGAGG + Intergenic
1198478026 X:137014760-137014782 CAGAAAGTCTCCTCTTAAAGAGG + Intergenic
1198585261 X:138113741-138113763 CAGAAAATCAAGAAATAAGGTGG - Intergenic
1199321827 X:146448616-146448638 CAGAAAATCAAATCAGAAGGAGG - Intergenic
1201171220 Y:11267266-11267288 CAGAAAATCTAGTGTTAATGAGG - Intergenic