ID: 1082854783

View in Genome Browser
Species Human (GRCh38)
Location 11:57796729-57796751
Sequence GTCCCGGGTGACCCGCATTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082854776_1082854783 25 Left 1082854776 11:57796681-57796703 CCACTATGAAGATGGTTATCCAG 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1082854783 11:57796729-57796751 GTCCCGGGTGACCCGCATTGAGG 0: 1
1: 0
2: 1
3: 1
4: 30
1082854779_1082854783 6 Left 1082854779 11:57796700-57796722 CCAGGTGGCAGTGATAACTATGG 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1082854783 11:57796729-57796751 GTCCCGGGTGACCCGCATTGAGG 0: 1
1: 0
2: 1
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082854783 Original CRISPR GTCCCGGGTGACCCGCATTG AGG Exonic
902530931 1:17090266-17090288 GTCCCGGGTGTCCCGGATCGTGG - Intronic
904815457 1:33193398-33193420 GTCCTGTGTGCCCTGCATTGTGG - Intergenic
1065810616 10:29439440-29439462 GTCCCATGTGACCTGCATGGTGG + Intergenic
1072189976 10:93070948-93070970 GACCTGGTTGACCTGCATTGGGG + Intergenic
1077424389 11:2467535-2467557 GTCCCATGTGACTCGGATTGTGG - Intronic
1082854783 11:57796729-57796751 GTCCCGGGTGACCCGCATTGAGG + Exonic
1083698304 11:64457299-64457321 TTCCCCTGTGACCCACATTGAGG + Intergenic
1117690357 14:58299210-58299232 GCCCCGGGGGACCCGCGTGGGGG - Intronic
1119410298 14:74426122-74426144 GTCCCGGGAGCCCCGCATCCTGG + Intergenic
1122985143 14:105208461-105208483 ATCCCGGGAGACCTGCTTTGGGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1131375423 15:91919108-91919130 GCCCCGGGTCACCCGCATTGTGG + Intronic
1133064073 16:3193553-3193575 GTCCCCGGCGACCCGAATGGAGG + Intergenic
1134250133 16:12568584-12568606 GCCCCGGGAGACCCGCAACGTGG + Exonic
1142473185 17:174644-174666 GTCCCGGGTGGCCCTCTTTTCGG + Intronic
1160592483 18:79951976-79951998 TCCCCGGGTGGCCCGCATTCAGG - Intergenic
1165153030 19:33772000-33772022 GTCCCGAGTGACCCTCTCTGTGG - Exonic
938697386 2:133846726-133846748 CTCCCGGCTTACCTGCATTGTGG - Intergenic
948387506 2:237590784-237590806 CTCCCGGGTCACCTGCTTTGAGG - Exonic
1172136560 20:32690341-32690363 GGGCCAGGTGACCCGCTTTGTGG - Intergenic
1175495559 20:59411793-59411815 GTCCCGGGTGCCCCTAAGTGGGG - Intergenic
1176052825 20:63129692-63129714 GTCCCCAGTGACCTGCACTGTGG - Intergenic
955395773 3:58556166-58556188 GTCCCGGGTCACCAGCTGTGGGG + Intergenic
976156122 4:82146744-82146766 GACCTGGGTGACCCCCAATGAGG - Intergenic
982203494 4:152980023-152980045 GTCCTGGGTGTCCTGCATTTTGG + Intergenic
982598372 4:157414189-157414211 GGCCCAGGTGACCCCCAGTGTGG - Intergenic
985590333 5:761307-761329 GCCCCGGGTGTCCTGCAGTGAGG - Intronic
986416006 5:7528937-7528959 GTCCTGTGTGACTCTCATTGGGG - Intronic
997359872 5:133288320-133288342 GTCCCGGGGGTCCCCCATGGTGG + Intronic
1005896978 6:30186542-30186564 GTCCAGGGTGACGCTCACTGTGG + Exonic
1016738580 6:147506933-147506955 GTCCCGGGTGACCCAAGTTTGGG + Intergenic
1028646165 7:93098909-93098931 GTCCCCCGTGACCTGCCTTGGGG - Intergenic
1192549453 X:72042389-72042411 GTCCCAGTTCACCCCCATTGGGG + Intergenic