ID: 1082855150

View in Genome Browser
Species Human (GRCh38)
Location 11:57799336-57799358
Sequence CTGGCCACCCACACCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082855150_1082855157 24 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855157 11:57799383-57799405 TGCTAGTTCACATAGAGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 116
1082855150_1082855159 30 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855150_1082855158 25 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855158 11:57799384-57799406 GCTAGTTCACATAGAGTTTTGGG 0: 1
1: 0
2: 2
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082855150 Original CRISPR CTGGCCACCCACACCCATCT GGG (reversed) Intronic