ID: 1082855150

View in Genome Browser
Species Human (GRCh38)
Location 11:57799336-57799358
Sequence CTGGCCACCCACACCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082855150_1082855159 30 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855150_1082855158 25 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855158 11:57799384-57799406 GCTAGTTCACATAGAGTTTTGGG 0: 1
1: 0
2: 2
3: 12
4: 98
1082855150_1082855157 24 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855157 11:57799383-57799405 TGCTAGTTCACATAGAGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082855150 Original CRISPR CTGGCCACCCACACCCATCT GGG (reversed) Intronic
900243237 1:1626597-1626619 CTGGGCAGCCACACACAGCTGGG + Intronic
902739323 1:18423835-18423857 CTGACCACCCATTCCCATCATGG - Intergenic
903017277 1:20369164-20369186 CTGGCGTCCAACACCCAGCTGGG - Intergenic
903902921 1:26661616-26661638 TTGGCCACCCTCAGTCATCTTGG - Intergenic
904440392 1:30525975-30525997 CTGTCCACTCACTCCCCTCTCGG - Intergenic
905862193 1:41359400-41359422 CTGGCTTCCCAGACCCATGTTGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906513302 1:46423744-46423766 CAGGGCACCCACGCACATCTCGG - Intergenic
907246960 1:53114729-53114751 ATTGCCACCCACACCCCGCTTGG - Intronic
907271631 1:53294853-53294875 CTCCCCACCCACACGCATCGTGG + Intronic
908109711 1:60884340-60884362 CTTGCCACCCCACCCCATCTTGG - Intronic
909965375 1:81902718-81902740 CTGACCACCCATTCCCATCATGG + Intronic
911437157 1:97876231-97876253 CTGGACATCCAAATCCATCTGGG + Intronic
916151504 1:161796701-161796723 CTGGTCACCCAAAACCATCAAGG - Intronic
917178563 1:172266712-172266734 CTATCCACCCACACCCCCCTTGG + Intronic
917790553 1:178496348-178496370 CTGACCACCCACCGCCATGTGGG + Intergenic
918043272 1:180926145-180926167 CTGACCACCCCAACCCTTCTAGG + Intronic
920449767 1:206051114-206051136 TTGGCCACCCACACCCAGGCAGG + Intronic
922610642 1:226924491-226924513 CTGGCCACACATACCCCCCTGGG + Intronic
923015815 1:230126131-230126153 CTGCCCCCACACACTCATCTAGG - Intronic
1062796820 10:351079-351101 CTGGTCCCCGACAGCCATCTCGG - Intronic
1062845115 10:697550-697572 CTGGCCACGCTTTCCCATCTGGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1064493326 10:15883354-15883376 CTGGCCATCCCAACCCAACTTGG - Intergenic
1065328181 10:24568867-24568889 ATGGCCACCCTCACCAATTTGGG + Intergenic
1067478652 10:46581806-46581828 CTGGGCACCCATCCCCATCCTGG - Intronic
1067616085 10:47759995-47760017 CTGGGCACCCATCCCCATCCTGG + Intergenic
1069818760 10:71214769-71214791 CAGGCCACCCCCAGCCTTCTTGG - Intronic
1070692836 10:78540461-78540483 CCTGTCACCCTCACCCATCTGGG - Intergenic
1071132208 10:82407618-82407640 CTGTCCACCCACGCACATCTAGG - Intronic
1074392945 10:113073049-113073071 CTGGCCACCAGCACCTAACTAGG - Intronic
1074535766 10:114327890-114327912 CTGTCCACTCACCCCCACCTGGG - Intronic
1075554851 10:123422946-123422968 CTGGCCACCCTTGCCCAGCTGGG - Intergenic
1076655005 10:132018095-132018117 CTGGGGACCCACAGCGATCTGGG + Intergenic
1076871332 10:133196424-133196446 CTGATCACCCACACCCAGCTCGG - Intronic
1077130170 11:968057-968079 CTCCACACCCTCACCCATCTCGG - Intronic
1077131325 11:974176-974198 CGGGCCACCCACTCCCTTCATGG - Intronic
1077131337 11:974220-974242 CGGGCCACCCACTCCCTTCATGG - Intronic
1077303380 11:1857146-1857168 CTGTCCACCGACACCCAGCTGGG + Intronic
1078341104 11:10498560-10498582 CTGGCCCCCCAAACCCGTCTAGG + Intronic
1080918158 11:36681026-36681048 CTGGCCCTGCACACCCCTCTAGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081582924 11:44364941-44364963 CTGTCCACCCAGAACCAGCTGGG + Intergenic
1081651027 11:44824358-44824380 CTGATCACCCACCCCCAACTGGG + Intronic
1082855150 11:57799336-57799358 CTGGCCACCCACACCCATCTGGG - Intronic
1083297055 11:61720502-61720524 CTGGCCGCCCATGCCCTTCTAGG + Intronic
1083472917 11:62896274-62896296 GTGCCCAGCCACACACATCTTGG - Intergenic
1084411747 11:69009799-69009821 CCTCCCACCCACACCCGTCTGGG + Intronic
1084557989 11:69886237-69886259 CAGGGAACCCACATCCATCTAGG - Intergenic
1084729237 11:71062580-71062602 CAGGCCACTCTCAGCCATCTGGG - Intronic
1089493986 11:118899370-118899392 CTGCCCTCCCCCACCCCTCTGGG - Exonic
1090378568 11:126308964-126308986 AGGGCCACCCCCACCCACCTGGG + Intronic
1090838633 11:130471506-130471528 GAGGCCACCCATACCCTTCTAGG + Intronic
1091113014 11:132988157-132988179 CTGACCACCCTCATCCATCCTGG - Intronic
1093418402 12:18947051-18947073 CCTGCCACCCACACCCATCATGG + Intergenic
1094180328 12:27585771-27585793 CTGCCCACCCACTCCCAAATGGG - Intronic
1094493331 12:30974985-30975007 CTGTCCTTCCACACCCAGCTCGG - Intronic
1096928276 12:55173483-55173505 CTGCCCACCTCCACCCAGCTGGG + Intergenic
1096971554 12:55670487-55670509 CTGGCCTACCACTTCCATCTAGG + Intergenic
1098324531 12:69287876-69287898 CTGGCTTCCCCAACCCATCTTGG - Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1104814465 12:131637804-131637826 CTGCCCACCCAGACCCATTCAGG - Intergenic
1105531024 13:21220594-21220616 GTGCCCACCCACCCCCAACTGGG - Intergenic
1106123647 13:26882533-26882555 CTTGCCATCCACGCTCATCTCGG + Intergenic
1106413335 13:29525944-29525966 CCGGCCACCCACTCCCACCCTGG + Intronic
1106524532 13:30528277-30528299 ATGGCCAACCACAACCAACTGGG + Intronic
1111277502 13:85968839-85968861 CTGGCCTTCCACAGCCATGTGGG + Intergenic
1113802213 13:113092532-113092554 CAGGCCACCCAGAACCACCTGGG - Intronic
1114551310 14:23534266-23534288 CTCTCCACCCACAGCCACCTGGG - Exonic
1114659737 14:24336445-24336467 CTCCCCACCCACCCCCAACTTGG - Intronic
1117763993 14:59061089-59061111 CTGGCCTTCCACACCAGTCTTGG + Intergenic
1119028559 14:71173864-71173886 CTGGCCTCCCTCTCCCACCTGGG + Intergenic
1119389417 14:74280986-74281008 CTGGCCAGCCTCACCCTGCTTGG + Intergenic
1119751713 14:77083288-77083310 CTGCCCACCTCCACCCTTCTAGG + Intergenic
1120888308 14:89469318-89469340 CTGGTCACCCTAACCCAACTGGG - Intronic
1121994668 14:98592998-98593020 CTGGCCTCCCACGCCCATCCCGG + Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1125187261 15:36945260-36945282 CTGGGCACCCAAATCTATCTGGG + Intronic
1127865137 15:63026454-63026476 CTTGTCCCCCACGCCCATCTTGG - Intergenic
1128618381 15:69128275-69128297 CTGGCCAACCACAGCCAACATGG + Intergenic
1130342651 15:83012289-83012311 CAGGCCACCCTCTCCCATTTAGG - Intergenic
1130838016 15:87670992-87671014 CATGCCACCCACACACATCCAGG + Intergenic
1131073467 15:89480209-89480231 ATGGCCACCTTCACCCATCATGG + Intronic
1131175941 15:90209879-90209901 CTTGCCACCCACCCACCTCTTGG - Intronic
1132699391 16:1215895-1215917 GTGCCCACACACACCCACCTTGG - Intronic
1132852977 16:2033133-2033155 CTGGCGCCCCCCACCCAGCTAGG - Intronic
1132980666 16:2737373-2737395 CCAGCCTCCCACACCCATCCTGG + Intergenic
1133720685 16:8491637-8491659 TTTGCCACCCACCCCCACCTTGG - Intergenic
1136428417 16:30183951-30183973 CCGGCCACCCACCTCCATCTTGG - Intronic
1137017477 16:35392452-35392474 CTGGCCAACCAGACCCAGCAAGG - Intergenic
1138288509 16:55828299-55828321 CTTGCCACCCACACACCTCCTGG + Intronic
1141840944 16:86573704-86573726 CTGGCATCCCAGACCCATTTAGG + Intergenic
1142286863 16:89175041-89175063 CTGCTCACCCACACCCACATTGG + Intronic
1142717014 17:1752769-1752791 GTGGCCACCCTCAGCCAGCTGGG + Exonic
1142865198 17:2786533-2786555 CTGCCCACACCCACCCAGCTGGG - Intronic
1143593895 17:7902747-7902769 CAGGCCTCCCACACCCACCAGGG - Intronic
1144032874 17:11337665-11337687 CTGGCCAAGCAAAGCCATCTTGG - Intronic
1144162161 17:12570226-12570248 CTGGGCACCACCACCCAACTGGG + Intergenic
1145263616 17:21368980-21369002 CTGGGCACCCACAGCCTCCTGGG - Intergenic
1148808795 17:50277809-50277831 CTGGCCTCCCACACCCCCCAAGG - Intronic
1151190104 17:72392132-72392154 CTGACCACCCACAACGGTCTTGG + Intergenic
1151991984 17:77581147-77581169 GTGTCCTCCCACACCCAACTGGG - Intergenic
1157018237 18:43745179-43745201 CTGACCACCCATTCCCATCATGG + Intergenic
1157547320 18:48555563-48555585 CTGGCCACCCACTCACCACTGGG + Intronic
1158202799 18:54959259-54959281 CTGGACACCCACACACATGGAGG + Intronic
1160726956 19:621590-621612 CTGGACGCCCTCACCCAACTGGG - Exonic
1161128881 19:2576470-2576492 GTGGCCACCCTCACACGTCTGGG + Intronic
1162131542 19:8529138-8529160 CTGGACACCCTCACCTACCTTGG - Intronic
1162823613 19:13237785-13237807 CTGGCCACCCAGCTCCACCTGGG + Intronic
1163023782 19:14497572-14497594 CTGGCCTGCCACAGCAATCTCGG - Intergenic
1163521538 19:17794899-17794921 CTTGCCACCCTCGCCCCTCTCGG - Intronic
1163833875 19:19561907-19561929 ATGGGCACCACCACCCATCTGGG + Exonic
1165411766 19:35666496-35666518 CTGGCCAGCCCCACCCACCGTGG - Exonic
1165455295 19:35907387-35907409 CCAGCCCCCCACCCCCATCTAGG + Intronic
1166227546 19:41406025-41406047 TTGGCCACCCACTCCCATTATGG + Intronic
1167075825 19:47248434-47248456 CAGGCGACCCACACCCGCCTCGG + Intergenic
1167312166 19:48743348-48743370 CTGCCCCCACACCCCCATCTAGG + Intronic
1167467137 19:49656237-49656259 CTGCTCCCCAACACCCATCTCGG - Intronic
1167490771 19:49791832-49791854 CTGGCCTCGCACACCCTTCCTGG + Intronic
1168128127 19:54298511-54298533 CGGGCCACCCCCAGCCACCTGGG - Intergenic
1168321345 19:55511838-55511860 CTGGCCCCCCACACTGATCCTGG - Intronic
926228603 2:10986046-10986068 CTGGCTCCCCTCACCCATCATGG - Intergenic
926249227 2:11144138-11144160 GTCCCCACCCACACCCACCTGGG - Exonic
927096040 2:19748220-19748242 CTGAGCAGCCACACCCATTTTGG - Intergenic
928595412 2:32855246-32855268 CTGTCCACACACACCCTCCTGGG - Intergenic
929949266 2:46393833-46393855 CTGGCCACTCACACCCTCATGGG + Intergenic
931246869 2:60499292-60499314 CTGCCCAGCCATACCCTTCTGGG + Intronic
933763088 2:85687491-85687513 CTGGCCACCCAGAATCATCACGG + Intronic
934537243 2:95145244-95145266 CTGACCACCCATTCCCATCATGG - Intronic
937275591 2:120681935-120681957 CTCACCAGCCAGACCCATCTTGG + Intergenic
940018967 2:149136473-149136495 CTGGTGACCCACTGCCATCTGGG - Intronic
940400401 2:153242279-153242301 CTTCCCACCCACACCCATCATGG + Intergenic
942142680 2:172993721-172993743 CTGGCCAGACACAGCCCTCTGGG - Intronic
946467506 2:219925080-219925102 CTGGGCACCTACCCCCATGTTGG - Intergenic
946930961 2:224670713-224670735 ATGGCCTCCCTCACACATCTGGG + Intergenic
948222578 2:236284440-236284462 CTCTCCACCCACACCCAGCTAGG + Intergenic
948381298 2:237551556-237551578 CTGGACACCAACACTCAACTAGG + Intronic
948691889 2:239711434-239711456 CTGGCCACCAACACCCAGCCTGG + Intergenic
1168878466 20:1186278-1186300 CTGTTCACCCACACCCACCTAGG - Intronic
1173804089 20:45912589-45912611 CCTGCCACCCACAATCATCTCGG + Intergenic
1173808316 20:45940608-45940630 CTGGCCACAGACACTCACCTTGG - Exonic
1174123302 20:48283589-48283611 CTGTCCACTCACGCCCATCCGGG + Intergenic
1175937379 20:62519982-62520004 CTGGCCACGCACAGGCAGCTGGG + Intergenic
1175945524 20:62556750-62556772 ATGGCCACACAAACCCACCTGGG - Intronic
1175993279 20:62800193-62800215 AAGGCCACCCCCACCCACCTGGG + Exonic
1176093263 20:63328368-63328390 CAGGCCCCCCATGCCCATCTTGG + Exonic
1178726432 21:35056634-35056656 CTGTCCCCCCACACCCTGCTTGG + Intronic
1180034439 21:45236511-45236533 CTGGCCACCCACCCCTTGCTTGG + Intergenic
1180819363 22:18815128-18815150 CTGGCCACCCTCACTGATCACGG + Intergenic
1180924502 22:19544429-19544451 CTGCCCACCCACACCCCTCTGGG + Intergenic
1181205588 22:21249573-21249595 CTGGCCACCCTCACTGATCACGG + Intergenic
1181474116 22:23158134-23158156 CTGGTCACTCACACCCACCACGG - Intronic
1183408719 22:37642733-37642755 CTGGCCACCCTCACTGACCTGGG - Intronic
1183664053 22:39237256-39237278 CTGGCCACCCACATCGATCCAGG + Intronic
1184006786 22:41716071-41716093 CTGGCCACCCTGACCCTTCTTGG + Exonic
1185070340 22:48652559-48652581 CTGGCCACCCAGCGCCATCCAGG + Intronic
1185237096 22:49720462-49720484 CATGCCAGCCACACCCAGCTGGG - Intergenic
1203221335 22_KI270731v1_random:45840-45862 CTGGCCACCCTCACTGATCACGG - Intergenic
1203269491 22_KI270734v1_random:40981-41003 CTGGCCACCCTCACTGATCACGG + Intergenic
949401594 3:3670310-3670332 GTTGCCACCCCCACCCATCTTGG - Intergenic
952528310 3:34237107-34237129 CTGCCCAGCCAAACCCAGCTGGG - Intergenic
952946606 3:38482139-38482161 CTGGCCATACACACACAGCTGGG - Intronic
953048402 3:39316495-39316517 CTGACCACCCATTCCCATCATGG - Intergenic
953360555 3:42292168-42292190 CTCACCACACACACCCAGCTGGG - Intergenic
954867720 3:53744052-53744074 CTGGCCACACTCAGCCACCTAGG + Intronic
956369421 3:68542228-68542250 CTGGCAACACACACACTTCTGGG + Intronic
960087912 3:113610587-113610609 ACGACCTCCCACACCCATCTGGG + Intronic
963108235 3:141664586-141664608 CTGGCACCCCAAACACATCTGGG + Intergenic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
968890391 4:3365609-3365631 CTGGCCTCCCACTCACCTCTGGG + Intronic
969197654 4:5576145-5576167 CAGCCCACCCATACCCACCTGGG - Intronic
975241303 4:72062822-72062844 CTGGCCTCTCTCACACATCTGGG - Intronic
976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG + Exonic
982455908 4:155609287-155609309 CTTGCCACCTCCACCCATCTAGG + Intergenic
985262443 4:188127701-188127723 CTGTCTACCCACACTCATCTGGG + Intergenic
985590489 5:761968-761990 CTGGCCACTCACAGCCATGATGG + Intronic
985591419 5:767298-767320 CTCCCCACCCACACACATGTGGG + Intergenic
988817615 5:34850321-34850343 CTGGCCACCCAAACCCAGCTGGG - Intronic
991420393 5:66435137-66435159 CAGGCCAGACACACCCATCGGGG - Intergenic
992559930 5:77941370-77941392 CTCCCCACCCACCCCCATCTTGG + Intergenic
997495345 5:134319128-134319150 CTGGCCAACCACAGCCAACACGG + Intronic
998575610 5:143312258-143312280 TTGGCCACACAGACCAATCTTGG - Intronic
999192622 5:149759817-149759839 GGGGCCACCCACACCCACCCTGG + Intronic
1001966782 5:175915210-175915232 CTTTCCACCCCCACACATCTGGG + Intergenic
1002192465 5:177485438-177485460 CTGGCCAGACCCACACATCTTGG - Intronic
1002250167 5:177923994-177924016 CTTTCCACCCCCACACATCTGGG - Intergenic
1002445055 5:179285537-179285559 CTGGCCAGCCAGACCCAGCCAGG + Intronic
1003391639 6:5718336-5718358 GTGCCCACCCACCCCCAACTGGG + Intronic
1003787076 6:9498470-9498492 CTGGCCACCCATTCTCATCATGG + Intergenic
1003907904 6:10719674-10719696 CTGGCCACCCACAGCCAGTAGGG - Intergenic
1005460907 6:26069424-26069446 TTGGCCACCAGCATCCATCTTGG + Intergenic
1006213118 6:32414364-32414386 CAGGCCCCCCACTCACATCTGGG - Intergenic
1007125441 6:39422289-39422311 CAGGCCCCCCAGACACATCTGGG - Intronic
1007203373 6:40130036-40130058 CTGGCCATCCACATCTATGTGGG + Intergenic
1008646500 6:53519712-53519734 CTGTCCACCCTCACCCAGCTGGG + Intronic
1016328604 6:142931983-142932005 CTGGGCACACACACCAATATGGG - Intronic
1018645947 6:165948679-165948701 CTGTCCACCCACAGCAATCTTGG - Intronic
1019136498 6:169911850-169911872 CTGGCCACCCCCACGGACCTAGG + Intergenic
1020130931 7:5558202-5558224 CTGGCCGCCCACAGCCTTCTGGG - Intronic
1022525455 7:31034263-31034285 CTGGTCACTCACACCCATGGGGG + Intergenic
1030754279 7:113269240-113269262 CTGTTCACCTTCACCCATCTTGG + Intergenic
1033036798 7:137882914-137882936 CTTACCACCCATAACCATCTAGG + Intronic
1033318161 7:140315695-140315717 CGGGCCACCCCCTCCCATCATGG + Intronic
1034224679 7:149473547-149473569 CTGGCCGCCCACCCCAACCTGGG - Exonic
1034265892 7:149780492-149780514 CTGGCCACCAACCCCCAGCATGG - Intergenic
1034490643 7:151391495-151391517 ATGGCCCCCCACACGCAGCTGGG + Intronic
1035225361 7:157429596-157429618 CAGGCCAGCCACATCCATCCTGG - Intergenic
1036411629 8:8506877-8506899 CTGGCCACCCAGCCCCAGCTTGG - Intergenic
1037389706 8:18380674-18380696 CTGGCCAGCCACACCCTGCATGG - Intergenic
1038503495 8:28064352-28064374 CTGGCTACCCACACCCTGCCAGG + Intronic
1038587094 8:28799809-28799831 CTAGCCAGCAACACCCAACTCGG + Intronic
1049270193 8:141691458-141691480 ATGGCCACCCACGGCCAACTGGG - Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1049537556 8:143189438-143189460 CAGGCCATCCCCACCCCTCTGGG + Intergenic
1056911594 9:90706140-90706162 CTGGACTCCCAGACCCCTCTGGG + Intergenic
1057619481 9:96621983-96622005 CTGGCCACTGCCACTCATCTGGG - Intergenic
1062076303 9:134591801-134591823 CTGTCCTCCCACACCCTGCTGGG + Intergenic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185916981 X:4046593-4046615 CTGTCCACCCACCCACATGTAGG - Intergenic
1185995295 X:4940750-4940772 CTGGGCTCACTCACCCATCTGGG - Intergenic
1187629152 X:21148803-21148825 CTGCCCTCCCACACCCAAGTAGG - Intergenic
1192130379 X:68544060-68544082 TTGGCCTCTCACAGCCATCTTGG - Intergenic
1192732011 X:73809842-73809864 CTGACCACCCACTTCCATCATGG - Intergenic
1195945881 X:110210928-110210950 CTGGCCAGCCCCACCCAGCATGG + Intronic
1198404092 X:136295484-136295506 CTGACCCTCCCCACCCATCTGGG + Intergenic
1201142637 Y:11041409-11041431 CTGGCCACCAGCCCCCATCCTGG - Intergenic
1201367754 Y:13227384-13227406 CTGGTCACACACACCCCTTTGGG + Intergenic