ID: 1082855153

View in Genome Browser
Species Human (GRCh38)
Location 11:57799355-57799377
Sequence AGGGATGGCAGAGAATGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082855153_1082855161 19 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855161 11:57799397-57799419 GAGTTTTGGGCCTGGTTCTTGGG 0: 1
1: 0
2: 2
3: 9
4: 159
1082855153_1082855157 5 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855157 11:57799383-57799405 TGCTAGTTCACATAGAGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 116
1082855153_1082855163 30 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855163 11:57799408-57799430 CTGGTTCTTGGGTTTGTTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 193
1082855153_1082855159 11 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855153_1082855160 18 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855160 11:57799396-57799418 AGAGTTTTGGGCCTGGTTCTTGG 0: 1
1: 0
2: 3
3: 21
4: 198
1082855153_1082855158 6 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855158 11:57799384-57799406 GCTAGTTCACATAGAGTTTTGGG 0: 1
1: 0
2: 2
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082855153 Original CRISPR AGGGATGGCAGAGAATGACC TGG (reversed) Intronic