ID: 1082855155

View in Genome Browser
Species Human (GRCh38)
Location 11:57799374-57799396
Sequence TATGTGAACTAGCACAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082855155_1082855161 0 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855161 11:57799397-57799419 GAGTTTTGGGCCTGGTTCTTGGG 0: 1
1: 0
2: 2
3: 9
4: 159
1082855155_1082855159 -8 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855155_1082855166 27 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855166 11:57799424-57799446 TTCCAGGGTAGCACTGGACTTGG 0: 1
1: 0
2: 1
3: 7
4: 136
1082855155_1082855164 12 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855164 11:57799409-57799431 TGGTTCTTGGGTTTGTTCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 199
1082855155_1082855165 21 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855165 11:57799418-57799440 GGTTTGTTCCAGGGTAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 112
1082855155_1082855163 11 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855163 11:57799408-57799430 CTGGTTCTTGGGTTTGTTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 193
1082855155_1082855160 -1 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855160 11:57799396-57799418 AGAGTTTTGGGCCTGGTTCTTGG 0: 1
1: 0
2: 3
3: 21
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082855155 Original CRISPR TATGTGAACTAGCACAACTA GGG (reversed) Intronic