ID: 1082855158

View in Genome Browser
Species Human (GRCh38)
Location 11:57799384-57799406
Sequence GCTAGTTCACATAGAGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082855153_1082855158 6 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855158 11:57799384-57799406 GCTAGTTCACATAGAGTTTTGGG 0: 1
1: 0
2: 2
3: 12
4: 98
1082855154_1082855158 -9 Left 1082855154 11:57799370-57799392 CCATCCCTAGTTGTGCTAGTTCA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1082855158 11:57799384-57799406 GCTAGTTCACATAGAGTTTTGGG 0: 1
1: 0
2: 2
3: 12
4: 98
1082855151_1082855158 24 Left 1082855151 11:57799337-57799359 CCAGATGGGTGTGGGTGGCCAGG 0: 1
1: 0
2: 2
3: 46
4: 307
Right 1082855158 11:57799384-57799406 GCTAGTTCACATAGAGTTTTGGG 0: 1
1: 0
2: 2
3: 12
4: 98
1082855150_1082855158 25 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855158 11:57799384-57799406 GCTAGTTCACATAGAGTTTTGGG 0: 1
1: 0
2: 2
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082855158 Original CRISPR GCTAGTTCACATAGAGTTTT GGG Intronic