ID: 1082855159

View in Genome Browser
Species Human (GRCh38)
Location 11:57799389-57799411
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082855156_1082855159 -9 Left 1082855156 11:57799375-57799397 CCTAGTTGTGCTAGTTCACATAG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855153_1082855159 11 Left 1082855153 11:57799355-57799377 CCAGGTCATTCTCTGCCATCCCT 0: 1
1: 0
2: 0
3: 27
4: 348
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855154_1082855159 -4 Left 1082855154 11:57799370-57799392 CCATCCCTAGTTGTGCTAGTTCA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855155_1082855159 -8 Left 1082855155 11:57799374-57799396 CCCTAGTTGTGCTAGTTCACATA 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855150_1082855159 30 Left 1082855150 11:57799336-57799358 CCCAGATGGGTGTGGGTGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154
1082855151_1082855159 29 Left 1082855151 11:57799337-57799359 CCAGATGGGTGTGGGTGGCCAGG 0: 1
1: 0
2: 2
3: 46
4: 307
Right 1082855159 11:57799389-57799411 TTCACATAGAGTTTTGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type