ID: 1082856195

View in Genome Browser
Species Human (GRCh38)
Location 11:57809383-57809405
Sequence GGTTATCGCTGAGAACTTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082856195 Original CRISPR GGTTATCGCTGAGAACTTGG AGG Exonic
901474678 1:9481319-9481341 GGGTCTGGCTGGGAACTTGGAGG - Intergenic
901658944 1:10786850-10786872 TGTTATCATTGGGAACTTGGGGG - Intronic
904386732 1:30147583-30147605 GGGAATCGCTGAGAACCTGTGGG + Intergenic
907894180 1:58668779-58668801 GGTTAGTGCTGAGAACTTGGTGG - Intronic
909022724 1:70450057-70450079 AGATATGCCTGAGAACTTGGTGG + Intergenic
913415381 1:118599805-118599827 GGAGATCACTGAGAACTTGCAGG - Intergenic
915619165 1:157069088-157069110 GGTTATTGCAGAAAACCTGGAGG - Intergenic
922855704 1:228773469-228773491 GGTGGTCGCTGAGTACTTGCTGG - Intergenic
1067920380 10:50449736-50449758 GGTTATCACTGATAACCTGTTGG - Intronic
1071274058 10:84036714-84036736 GTTTAGCACTGAGATCTTGGGGG - Intergenic
1072691564 10:97575353-97575375 GGTCATCACTGAGAACTTAAGGG + Intronic
1075320906 10:121491172-121491194 GGCTTTCGCTGAGAAGATGGTGG - Intronic
1082856195 11:57809383-57809405 GGTTATCGCTGAGAACTTGGAGG + Exonic
1083443945 11:62694801-62694823 GGTTGTGGCTGAGTATTTGGGGG - Intronic
1086041863 11:82488806-82488828 GGTCATCGCTGAGATTATGGTGG + Intergenic
1087013686 11:93536638-93536660 AGTTATCTCTGAGGACCTGGAGG + Intronic
1092075762 12:5672033-5672055 GGTTCTCGCTGAGGACTGGAAGG + Intronic
1096127787 12:49132288-49132310 GGTTATAGCTTAGTGCTTGGAGG + Intergenic
1096203449 12:49703000-49703022 GGTGATGACTGACAACTTGGGGG - Intronic
1097946448 12:65374360-65374382 GGTTATAGCTGTGAACAGGGTGG + Intronic
1099308125 12:80983479-80983501 GGATATTGCTAAAAACTTGGAGG + Intronic
1101674126 12:106902284-106902306 GGTAATCGTTGAGCACCTGGAGG + Intergenic
1102356968 12:112245533-112245555 GGTTCTCCCTGAGAACTTCAGGG - Intronic
1102368108 12:112357049-112357071 GGTCATTACTGTGAACTTGGAGG - Intronic
1105074947 13:16003353-16003375 GGATATTTCTGAGAAGTTGGAGG + Intergenic
1105075239 13:16008966-16008988 GGATATTTCTGAGAAGTTGGAGG + Intergenic
1105075541 13:16014606-16014628 GGATATTTCTGAGAAGTTGGAGG + Intergenic
1105075845 13:16020244-16020266 GGATATTTCTGAGAAGTTGGAGG + Intergenic
1106186622 13:27415465-27415487 GGTCATGTCTGAGAACTTGCAGG - Intergenic
1106621179 13:31372693-31372715 GGTAAACCCTGAGAACTTTGTGG - Intergenic
1114265947 14:21072662-21072684 GCTTATGGCTGAGAACTCGAGGG - Intronic
1118505380 14:66405235-66405257 GGTTGTCCCTGATAACTTAGAGG - Intergenic
1123227512 15:17057086-17057108 GGATATTTCTGAGAAGTTGGAGG + Intergenic
1123586408 15:21764472-21764494 GGTTCTCGCTGAGGACTGGAAGG - Intergenic
1123623047 15:22207052-22207074 GGTTCTCGCTGAGGACTGGAAGG - Intergenic
1126961829 15:54005091-54005113 GGATATCCCTCAGGACTTGGAGG - Intergenic
1128694436 15:69749995-69750017 GGTTATAGATGAGATCATGGAGG + Intergenic
1129079774 15:73028805-73028827 GTTTACTGATGAGAACTTGGAGG + Intergenic
1131316034 15:91338556-91338578 GTGTATCTGTGAGAACTTGGCGG + Intergenic
1131739361 15:95370542-95370564 GTTTATCTCTGAGAATTTGGAGG + Intergenic
1131896948 15:97043842-97043864 TGTTACAGCTGAGAACATGGAGG + Intergenic
1133281299 16:4666934-4666956 GGTTTCTGCTGAGAACCTGGCGG + Intronic
1136907523 16:34113458-34113480 GGATATTGCTGAGCACTTTGAGG + Intergenic
1140301132 16:73758350-73758372 TGTTATCTCTGAGAACTCTGTGG - Intergenic
1142744432 17:1948633-1948655 TGGTATCACTGAGGACTTGGTGG - Intronic
1145901666 17:28494073-28494095 GGTCAGCCCTGGGAACTTGGAGG - Exonic
1146833707 17:36092397-36092419 GGGTATCACTGAGAGCTGGGAGG - Intergenic
1151132024 17:71907141-71907163 AGGTAACGCTGAGAATTTGGAGG + Intergenic
1159910843 18:74144851-74144873 GGTTTTCAGTAAGAACTTGGTGG - Intronic
1163880515 19:19916887-19916909 GGCTCTCACTGAGAACTTGAAGG - Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
932661028 2:73652190-73652212 GGTTATTGATGAGAGATTGGGGG - Intergenic
933020622 2:77186278-77186300 GGTGATCTCTGAGAGCTTCGTGG - Intronic
934517096 2:94995533-94995555 GGTTGTGGGTGAGAACTGGGAGG - Intergenic
938108732 2:128550463-128550485 GGTTCTGGCTGAAAACCTGGAGG + Intergenic
938597749 2:132805845-132805867 GGTGATTTCTGAGAATTTGGTGG + Intronic
944656924 2:201884723-201884745 GCTTATCTCTGAGAATATGGAGG + Intronic
945088847 2:206160012-206160034 GGTAATCGTTGAGCACCTGGAGG - Exonic
948851219 2:240707448-240707470 TCTTCTCTCTGAGAACTTGGTGG + Intergenic
1169180191 20:3558073-3558095 GGTTATCTCTGGGACTTTGGAGG - Intronic
1171150750 20:22824674-22824696 GGTTACCTCTGAGAATTTGAGGG - Intergenic
1171742980 20:28925403-28925425 GGATATTTCTGAGAAGTTGGAGG - Intergenic
1171762800 20:29224783-29224805 GGATATTGCTGAGCACTTTGAGG + Intergenic
1175289603 20:57866808-57866830 GGATTTTTCTGAGAACTTGGTGG + Intergenic
1176761154 21:10792728-10792750 GGATATTTCTGAGAAGTTGGAGG + Intergenic
960064642 3:113357555-113357577 GGTTCTTTCTGAGGACTTGGTGG - Intronic
964968246 3:162525778-162525800 CATTATCACTTAGAACTTGGGGG + Intergenic
967263443 3:187668971-187668993 GGGTCTCGCTGAAGACTTGGAGG + Exonic
969700156 4:8763439-8763461 TGTGATCGCAGAGAACCTGGAGG - Intergenic
969878598 4:10154802-10154824 GGTCATCTCTAAGAACTAGGGGG + Intergenic
971227772 4:24770664-24770686 GGTAACGGGTGAGAACTTGGGGG - Intergenic
973155949 4:46952696-46952718 GCTTAGGGATGAGAACTTGGTGG + Intronic
983854277 4:172622560-172622582 TGAAATTGCTGAGAACTTGGAGG - Intronic
985122451 4:186657826-186657848 AGTTATTGCTTTGAACTTGGGGG - Intronic
986432494 5:7694907-7694929 GGTTGTGGATGAGAACCTGGAGG - Intronic
991581460 5:68159839-68159861 GGTAATCGTTGAGCACCTGGAGG + Intergenic
992395426 5:76364997-76365019 GGGTATCTCTGAGTACTTGATGG - Intergenic
993759194 5:91770926-91770948 ACTAATCGCTGAGATCTTGGTGG + Intergenic
996345874 5:122487712-122487734 GGCTATTGATGAGAACTTCGGGG + Intergenic
1004302698 6:14472953-14472975 GGCTGTCAGTGAGAACTTGGAGG + Intergenic
1015331236 6:131981720-131981742 GGTTCTTGCTGTGATCTTGGTGG + Intergenic
1021602047 7:22373862-22373884 GGGTATAGCTGAGAGCTTGGAGG + Intergenic
1025521858 7:61744102-61744124 GGTTATTTCTGAGCACTTTGAGG - Intergenic
1025545583 7:62162391-62162413 GGTTATTTCTGAGCACTTTGAGG - Intergenic
1025951041 7:66145707-66145729 GGTTTTGGCTGATGACTTGGCGG + Intronic
1028828752 7:95304148-95304170 GGTGATTGCTAGGAACTTGGGGG - Intronic
1032406856 7:131662570-131662592 GGTAATCGTTGAGCACCTGGAGG + Intergenic
1034033377 7:147792345-147792367 GCTTAGGGCTGAGAAGTTGGCGG - Intronic
1037120424 8:15279048-15279070 GGTGATCGCTGATAACGTGTTGG + Intergenic
1038133755 8:24763485-24763507 GGCAATGGCTGAGAACATGGAGG - Intergenic
1039309830 8:36304912-36304934 TGTTTCCGCTGAGAAGTTGGGGG - Intergenic
1041180153 8:55238670-55238692 GGTTTTCGCTGGGCAGTTGGTGG - Intronic
1042221528 8:66479093-66479115 GGTTATAGCTGAGTATCTGGGGG - Intronic
1044506524 8:93026464-93026486 CATTCTCGCTGAGACCTTGGAGG - Intergenic
1046480027 8:114804031-114804053 GGTTATTCCTGTGAAGTTGGTGG - Intergenic
1049390293 8:142364310-142364332 GGTACTCGATTAGAACTTGGAGG + Intronic
1203382075 Un_KI270435v1:61869-61891 GGATATTTCTGAGAAGTTGGAGG + Intergenic
1203358303 Un_KI270442v1:184919-184941 GGATATTGCTGAGCACTTTGAGG + Intergenic
1203402125 Un_KI270519v1:117648-117670 GGATATTGCTGAGCACTTTGAGG + Intergenic
1187983869 X:24789015-24789037 GGTAATCGTTGAGCACCTGGAGG + Intronic
1195112461 X:101661127-101661149 GGTTTCCTCTGGGAACTTGGGGG - Intergenic
1196498989 X:116355785-116355807 GGCTATCGCTGAAAACTCTGGGG - Intergenic
1198512754 X:137370485-137370507 GGTTATTGCTGACAACCTGGAGG + Intergenic