ID: 1082860555

View in Genome Browser
Species Human (GRCh38)
Location 11:57851642-57851664
Sequence GGATGAAGCCAATTTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082860555_1082860558 -10 Left 1082860555 11:57851642-57851664 CCAAGATGAAATTGGCTTCATCC No data
Right 1082860558 11:57851655-57851677 GGCTTCATCCCTGGGATGCAAGG 0: 8412
1: 4364
2: 2744
3: 2707
4: 3046
1082860555_1082860559 -6 Left 1082860555 11:57851642-57851664 CCAAGATGAAATTGGCTTCATCC No data
Right 1082860559 11:57851659-57851681 TCATCCCTGGGATGCAAGGCTGG 0: 8748
1: 4163
2: 2323
3: 2300
4: 3400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082860555 Original CRISPR GGATGAAGCCAATTTCATCT TGG (reversed) Intergenic
No off target data available for this crispr