ID: 1082862037

View in Genome Browser
Species Human (GRCh38)
Location 11:57866319-57866341
Sequence CGCTCTGCAGAGGAAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862037_1082862039 -2 Left 1082862037 11:57866319-57866341 CCTGAAGCTTCCTCTGCAGAGCG No data
Right 1082862039 11:57866340-57866362 CGCCCTTCACCTCCTTGTTGCGG No data
1082862037_1082862048 27 Left 1082862037 11:57866319-57866341 CCTGAAGCTTCCTCTGCAGAGCG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862037_1082862045 14 Left 1082862037 11:57866319-57866341 CCTGAAGCTTCCTCTGCAGAGCG No data
Right 1082862045 11:57866356-57866378 GTTGCGGAGGCTATAGATGAAGG No data
1082862037_1082862046 15 Left 1082862037 11:57866319-57866341 CCTGAAGCTTCCTCTGCAGAGCG No data
Right 1082862046 11:57866357-57866379 TTGCGGAGGCTATAGATGAAGGG No data
1082862037_1082862042 1 Left 1082862037 11:57866319-57866341 CCTGAAGCTTCCTCTGCAGAGCG No data
Right 1082862042 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
1082862037_1082862047 26 Left 1082862037 11:57866319-57866341 CCTGAAGCTTCCTCTGCAGAGCG No data
Right 1082862047 11:57866368-57866390 ATAGATGAAGGGATTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862037 Original CRISPR CGCTCTGCAGAGGAAGCTTC AGG (reversed) Intergenic