ID: 1082862040

View in Genome Browser
Species Human (GRCh38)
Location 11:57866342-57866364
Sequence CTCCGCAACAAGGAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862040_1082862047 3 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862047 11:57866368-57866390 ATAGATGAAGGGATTGAGCATGG No data
1082862040_1082862046 -8 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862046 11:57866357-57866379 TTGCGGAGGCTATAGATGAAGGG No data
1082862040_1082862049 15 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data
1082862040_1082862048 4 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862040_1082862050 27 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data
1082862040_1082862045 -9 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862045 11:57866356-57866378 GTTGCGGAGGCTATAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862040 Original CRISPR CTCCGCAACAAGGAGGTGAA GGG (reversed) Intergenic