ID: 1082862041

View in Genome Browser
Species Human (GRCh38)
Location 11:57866343-57866365
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862041_1082862046 -9 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
Right 1082862046 11:57866357-57866379 TTGCGGAGGCTATAGATGAAGGG No data
1082862041_1082862050 26 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data
1082862041_1082862048 3 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862041_1082862047 2 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
Right 1082862047 11:57866368-57866390 ATAGATGAAGGGATTGAGCATGG No data
1082862041_1082862045 -10 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
Right 1082862045 11:57866356-57866378 GTTGCGGAGGCTATAGATGAAGG No data
1082862041_1082862049 14 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862041 Original CRISPR CCTCCGCAACAAGGAGGTGA AGG (reversed) Intergenic