ID: 1082862043

View in Genome Browser
Species Human (GRCh38)
Location 11:57866349-57866371
Sequence CTATAGCCTCCGCAACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862043_1082862050 20 Left 1082862043 11:57866349-57866371 CCTCCTTGTTGCGGAGGCTATAG No data
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data
1082862043_1082862047 -4 Left 1082862043 11:57866349-57866371 CCTCCTTGTTGCGGAGGCTATAG No data
Right 1082862047 11:57866368-57866390 ATAGATGAAGGGATTGAGCATGG No data
1082862043_1082862048 -3 Left 1082862043 11:57866349-57866371 CCTCCTTGTTGCGGAGGCTATAG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862043_1082862049 8 Left 1082862043 11:57866349-57866371 CCTCCTTGTTGCGGAGGCTATAG No data
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862043 Original CRISPR CTATAGCCTCCGCAACAAGG AGG (reversed) Intergenic