HTGT WGE

Individual CRISPR Summary

ID: 1082862044

 View in Genome Browser
Species Human (GRCh38)
Location 11:57866352-57866374
Sequence CATCTATAGCCTCCGCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 6, 2: 3, 3: 15, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862044_1082862047 -7 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG 0: 1
1: 6
2: 3
3: 15
4: 195
Right 1082862047 11:57866368-57866390 ATAGATGAAGGGATTGAGCATGG No data
1082862044_1082862048 -6 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG 0: 1
1: 6
2: 3
3: 15
4: 195
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG 0: 1
1: 2
2: 62
3: 129
4: 622
1082862044_1082862049 5 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG 0: 1
1: 6
2: 3
3: 15
4: 195
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data
1082862044_1082862051 28 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG 0: 1
1: 6
2: 3
3: 15
4: 195
Right 1082862051 11:57866403-57866425 TGTAGAAGACGGACACTACTTGG No data
1082862044_1082862050 17 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG 0: 1
1: 6
2: 3
3: 15
4: 195
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862044 Original CRISPR CATCTATAGCCTCCGCAACA AGG (reversed) Intergenic