ID: 1082862048

View in Genome Browser
Species Human (GRCh38)
Location 11:57866369-57866391
Sequence TAGATGAAGGGATTGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862044_1082862048 -6 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862043_1082862048 -3 Left 1082862043 11:57866349-57866371 CCTCCTTGTTGCGGAGGCTATAG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862040_1082862048 4 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862037_1082862048 27 Left 1082862037 11:57866319-57866341 CCTGAAGCTTCCTCTGCAGAGCG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862038_1082862048 17 Left 1082862038 11:57866329-57866351 CCTCTGCAGAGCGCCCTTCACCT No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data
1082862041_1082862048 3 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG No data
Right 1082862048 11:57866369-57866391 TAGATGAAGGGATTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862048 Original CRISPR TAGATGAAGGGATTGAGCAT GGG Intergenic