ID: 1082862049

View in Genome Browser
Species Human (GRCh38)
Location 11:57866380-57866402
Sequence ATTGAGCATGGGAATTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862038_1082862049 28 Left 1082862038 11:57866329-57866351 CCTCTGCAGAGCGCCCTTCACCT No data
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data
1082862044_1082862049 5 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG No data
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data
1082862043_1082862049 8 Left 1082862043 11:57866349-57866371 CCTCCTTGTTGCGGAGGCTATAG No data
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data
1082862040_1082862049 15 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data
1082862041_1082862049 14 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1082862049 11:57866380-57866402 ATTGAGCATGGGAATTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862049 Original CRISPR ATTGAGCATGGGAATTATGA TGG Intergenic