ID: 1082862050

View in Genome Browser
Species Human (GRCh38)
Location 11:57866392-57866414
Sequence AATTATGATGGTGTAGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862040_1082862050 27 Left 1082862040 11:57866342-57866364 CCCTTCACCTCCTTGTTGCGGAG No data
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data
1082862043_1082862050 20 Left 1082862043 11:57866349-57866371 CCTCCTTGTTGCGGAGGCTATAG No data
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data
1082862041_1082862050 26 Left 1082862041 11:57866343-57866365 CCTTCACCTCCTTGTTGCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data
1082862044_1082862050 17 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG No data
Right 1082862050 11:57866392-57866414 AATTATGATGGTGTAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862050 Original CRISPR AATTATGATGGTGTAGAAGA CGG Intergenic