ID: 1082862051

View in Genome Browser
Species Human (GRCh38)
Location 11:57866403-57866425
Sequence TGTAGAAGACGGACACTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082862044_1082862051 28 Left 1082862044 11:57866352-57866374 CCTTGTTGCGGAGGCTATAGATG No data
Right 1082862051 11:57866403-57866425 TGTAGAAGACGGACACTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082862051 Original CRISPR TGTAGAAGACGGACACTACT TGG Intergenic