ID: 1082862051 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:57866403-57866425 |
| Sequence | TGTAGAAGACGGACACTACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082862044_1082862051 | 28 | Left | 1082862044 | 11:57866352-57866374 | CCTTGTTGCGGAGGCTATAGATG | No data | ||
| Right | 1082862051 | 11:57866403-57866425 | TGTAGAAGACGGACACTACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082862051 | Original CRISPR | TGTAGAAGACGGACACTACT TGG | Intergenic | ||