ID: 1082866012

View in Genome Browser
Species Human (GRCh38)
Location 11:57900813-57900835
Sequence CCAAGACCTTAACTACACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082866012_1082866024 15 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG No data
1082866012_1082866023 14 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866023 11:57900850-57900872 TTGGTGCTAGGAGAAGTGTGGGG No data
1082866012_1082866015 -5 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866015 11:57900831-57900853 CTTGGCCTTTGGAAGCCCCTTGG No data
1082866012_1082866022 13 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866022 11:57900849-57900871 CTTGGTGCTAGGAGAAGTGTGGG No data
1082866012_1082866021 12 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866021 11:57900848-57900870 CCTTGGTGCTAGGAGAAGTGTGG No data
1082866012_1082866017 2 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866017 11:57900838-57900860 TTTGGAAGCCCCTTGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082866012 Original CRISPR CCAAGACCTTAACTACACAA TGG (reversed) Intergenic
No off target data available for this crispr