ID: 1082866016

View in Genome Browser
Species Human (GRCh38)
Location 11:57900836-57900858
Sequence TAGCACCAAGGGGCTTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082866016_1082866023 -9 Left 1082866016 11:57900836-57900858 CCTTTGGAAGCCCCTTGGTGCTA No data
Right 1082866023 11:57900850-57900872 TTGGTGCTAGGAGAAGTGTGGGG No data
1082866016_1082866022 -10 Left 1082866016 11:57900836-57900858 CCTTTGGAAGCCCCTTGGTGCTA No data
Right 1082866022 11:57900849-57900871 CTTGGTGCTAGGAGAAGTGTGGG No data
1082866016_1082866025 13 Left 1082866016 11:57900836-57900858 CCTTTGGAAGCCCCTTGGTGCTA No data
Right 1082866025 11:57900872-57900894 GGTGATCTTCACCTTTTGTAAGG No data
1082866016_1082866024 -8 Left 1082866016 11:57900836-57900858 CCTTTGGAAGCCCCTTGGTGCTA No data
Right 1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082866016 Original CRISPR TAGCACCAAGGGGCTTCCAA AGG (reversed) Intergenic
No off target data available for this crispr