ID: 1082866017

View in Genome Browser
Species Human (GRCh38)
Location 11:57900838-57900860
Sequence TTTGGAAGCCCCTTGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082866012_1082866017 2 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866017 11:57900838-57900860 TTTGGAAGCCCCTTGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082866017 Original CRISPR TTTGGAAGCCCCTTGGTGCT AGG Intergenic
No off target data available for this crispr