ID: 1082866022

View in Genome Browser
Species Human (GRCh38)
Location 11:57900849-57900871
Sequence CTTGGTGCTAGGAGAAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082866016_1082866022 -10 Left 1082866016 11:57900836-57900858 CCTTTGGAAGCCCCTTGGTGCTA No data
Right 1082866022 11:57900849-57900871 CTTGGTGCTAGGAGAAGTGTGGG No data
1082866012_1082866022 13 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866022 11:57900849-57900871 CTTGGTGCTAGGAGAAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082866022 Original CRISPR CTTGGTGCTAGGAGAAGTGT GGG Intergenic
No off target data available for this crispr